Previous Contig 004398:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013D09Sequence544004398 (4)pir|D86364|D863642e-27hypothetical protein F10G19.3 - Arabidopsis thaliana>gb:AE005172_891253 Arabidop
JMFF014F03Sequence595004398 (4)pir|D86364|D863643e-30hypothetical protein F10G19.3 - Arabidopsis thaliana>gb:AE005172_891253 Arabidop
JMSF002D11Sequence237004398 (4)gb:AF154045_4839235e-05Streptococcus pneumoniae strain g383 surface protein PspC (pspC) gene, pspC-6.8
JMSF041K07Sequence819004398 (4)pir|E96734|E967348e-32unknown protein F23N20.1 [imported] - Arabidopsis thaliana>gb:AE005173_894679 Ar

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041K07+ CGTGCA
                      ____________________________________________________________
consensus CGTGCA
 
. : . : . : . : . : . :
JMSF041K07+ CAGAACCAGAAATTCCCCGGGACACAATCCTCGGGTGATGATGGCGAATTCATCGCGCTT
                      ____________________________________________________________
consensus CAGAACCAGAAATTCCCCGGGACACAATCCTCGGGTGATGATGGCGAATTCATCGCGCTT
 
. : . : . : . : . : . :
JMSF041K07+ TCTGATTCGAGAATCGTCCTACTAGAACCACAGTCGTTTGTGCCATTAACTAACGGGACT
                      ____________________________________________________________
consensus TCTGATTCGAGAATCGTCCTACTAGAACCACAGTCGTTTGTGCCATTAACTAACGGGACT
 
. : . : . : . : . : . :
JMSF041K07+ GGAATTCCCCCCGTCTTTGCTCTAACTTCATGATCGATGTTGCCAATATTTTCTATGTGC
                      ____________________________________________________________
consensus GGAATTCCCCCCGTCTTTGCTCTAACTTCATGATCGATGTTGCCAATATTTTCTATGTGC
 
. : . : . : . : . : . :
JMSF041K07+ AAACTTCCGATTGCCCTGTTGCTTGGCTGAAGGTGAAGGGGATCTATTTCTTTATCCAAG
                      ____________________________________________________________
consensus AAACTTCCGATTGCCCTGTTGCTTGGCTGAAGGTGAAGGGGATCTATTTCTTTATCCAAG
 
. : . : . : . : . : . :
JMSF041K07+ GGCTGGGATAGTGTGCGAGCTAATATAGTCGAATTTATAGGCCCACCGTATCTTTCTGTG
JMFF014F03+ GGCTGGGATAGTGTGCGAGCTAATATAGTCGAATTTATAGGCCCACCGTATCTTTCTGTG
JMFF013D09+ CTTTCTGTG
                      ____________________________________________________________
consensus GGCTGGGATAGTGTGCGAGCTAATATAGTCGAATTTATAGGCCCACCGTATCTTTCTGTG
 
. : . : . : . : . : . :
JMSF041K07+ GCTCTTCTCAACTGTGCCCTGAGCAAGTGAACCTGTTCCGTTACTTCCTCGGATATGTCT
JMFF014F03+ GCTCTTCTCAACTGTGCCCTGAGCAAGTGAACCTGTTCCGTTACTTCCTCGGATATGTCT
JMFF013D09+ GCTCTTCTCAACTGTGCCCTGAGCAAGTGAACCTGTTCCGTTACTTCCTCGGATATGTCT
                      ____________________________________________________________
consensus GCTCTTCTCAACTGTGCCCTGAGCAAGTGAACCTGTTCCGTTACTTCCTCGGATATGTCT
 
. : . : . : . : . : . :
JMSF041K07+ AAATGATCATATGGAAAGTTTCCCAGGGCCTTCTCCAATTTCCAAGTCACACATTGAAAT
JMFF014F03+ AAATGATCATATGGAAAGTTTCCCAGGGCCTTCTCCAATTTCCAAGTCACACATTGAAAT
JMFF013D09+ AAATGATCATATGGAAAGTTTCCCAGGGCCTTCTCCAATTTCCAAGTCACACATTGAAAT
                      ____________________________________________________________
consensus AAATGATCATATGGAAAGTTTCCCAGGGCCTTCTCCAATTTCCAAGTCACACATTGAAAT
 
. : . : . : . : . : . :
JMSF041K07+ TGAAAATGGATTTTCTTCATCACCCCATCAGATGAGATCTTGGAATCAATGTCGTTAGCC
JMFF014F03+ TGAAAATGGATTTTCTTCATCACCCCATCAGATGAGATCTTGGAATCAATGTCGTTAGCC
JMFF013D09+ TGAAAATGGATTTTCTTCATCACCCCATCAGATGAGATCTTGGAATCAATGTCGTTAGCC
                      ____________________________________________________________
consensus TGAAAATGGATTTTCTTCATCACCCCATCAGATGAGATCTTGGAATCAATGTCGTTAGCC
 
. : . : . : . : . : . :
JMSF041K07+ GTGAGGAGAACCCTTTTAGCAGCCTGGAGAGCTAGCGAGAGATCAGACAAGCAAGACCCG
JMFF014F03+ GTGAGGAGAACCCTTTTAGCAGCCTGGAGAGCTAGCGAGAGATCAGACAAGCAAGACCCG
JMFF013D09+ GTGAGGAGAACCCTTTTAGCAGCCTGGAGAGCTAGCGAGAGATCAGACAAGCAAGACCCG
                      ____________________________________________________________
consensus GTGAGGAGAACCCTTTTAGCAGCCTGGAGAGCTAGCGAGAGATCAGACAAGCAAGACCCG
 
. : . : . : . : . : . :
JMSF041K07+ GAAGACGAAGACGAAGAAGATGAAGAAGAAGAAGAGCCCATAACCAAATGGGCCTTGAAA
JMFF014F03+ GAAGACGAAGACGAAGAAGATGAAGAAGAAGAAGAGCCCATAACCAAATGGGCCTTGAAA
JMFF013D09+ GAAGACGAAGACGAAGAAGATGAAGAAGAAGAAGAGCCCATAACCAAATGGGCCTTGAAA
                      ____________________________________________________________
consensus GAAGACGAAGACGAAGAAGATGAAGAAGAAGAAGAGCCCATAACCAAATGGGCCTTGAAA
 
. : . : . : . : . : . :
JMSF041K07+ TCTCTGATCTCCTCAAGCAAATGAGCAAGAAGTGAGACCCTGCGAGCTAAATCCGTGCAG
JMFF014F03+ TCTCTGATCTCCTCAAGCAAATGAGCAAGAAGTGAGACCCTGCGAGCTAAATCCGTGCAG
JMFF013D09+ TCTCTGATCTCCTCAAGCAAATGAGCAAGAAGTGAGACCCTGCGAGCTAAATCCGTGCAG
JMSF002D11+ CTGATCTCCTCAAGCAAATGAGCAAGAAGTGAGACCCTGCGAGCTAAATCCGTGCAG
                      ____________________________________________________________
consensus TCTCTGATCTCCTCAAGCAAATGAGCAAGAAGTGAGACCCTGCGAGCTAAATCCGTGCAG
 
. : . : . : . : . : . :
JMSF041K07+ TCTCTCTTGAAGGCGCCCGAGAAGCCCGAGCCGGAGATCCGCACTACGTCGTGAACTGCC
JMFF014F03+ TCTCTCTTGAAGGCGCCCGAGAAGCCCGAGCCGGAGATCCGCACTACGTCGTGAACTGCC
JMFF013D09+ TCTCTCTTGAAGGCGCCCGAGAAGCCCGAGCCGGAGATCCGCACTACGTCGTGAACTGCC
JMSF002D11+ TCTCTCTTGAAGGCGCCCGAGAAGCCCGAGCCGGAGATCCGCACTACGTCGTGAACTGCC
                      ____________________________________________________________
consensus TCTCTCTTGAAGGCGCCCGAGAAGCCCGAGCCGGAGATCCGCACTACGTCGTGAACTGCC
 
. : . : . : . : . : . :
JMSF041K07+ CGGAGAGCGGTCTCGATGGACTCACCGGCGACGGCGGCGATGGTGTCTCCGCCGGCCATT
JMFF014F03+ CGGAGAGCGGTCTCGATGGACTCACCGGCGACGGCGGCGATGGTGTCTCCGCCGGCCATT
JMFF013D09+ CGGAGAGCGGTCTCGATGGACTCACCGGCGACGGCGGCGATGGTGTCTCCGCCGGCCATT
JMSF002D11+ CGGAGAGCGGTCTCGATGGACTCACCGGCGACGGCGGCGATGGTGTCTCCGCCGGCCATT
                      ____________________________________________________________
consensus CGGAGAGCGGTCTCGATGGACTCACCGGCGACGGCGGCGATGGTGTCTCCGCCGGCCATT
 
. : . : . : . : . : . :
JMSF041K07+ CTTGTTGGTTGGTGGTGCTGTGAACTGGGATCC
JMFF014F03+ CTTGTTGGTTGGTGGTGCTGTGAACTGGGATCCGTATTTACAACCACAATG
JMFF013D09+ CTTGTTGGTTGGTGGTGCTGTGAACTGGGATCCGTATTTACAACCACAATG
JMSF002D11+ CTTGTTGGTTGGTGGTGCTGTGAACTGGGATCCGTATTTACAACCACAATGTCGTGAATC
                      ____________________________________________________________
consensus CTTGTTGGTTGGTGGTGCTGTGAACTGGGATCCGTATTTACAACCACAATGTCGTGAATC