Previous Contig 004395:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002J22Sequence530004395 (33)gb:AJ843122_18145071e-49Plantago major mRNA for vacuolar H+-ATPase C subunit (vatpc1 gene).790004395 (33)sp|Q40585|VATL_TOBAC9e-54Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169
JMFF009A06Sequence569004395 (33)gb:AJ843122_18145076e-51Plantago major mRNA for vacuolar H+-ATPase C subunit (vatpc1 gene).674004395 (33)sp|Q40585|VATL_TOBAC4e-53Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169
JMFF009A17Sequence330004395 (33)gb:AJ843122_18145071e-18Plantago major mRNA for vacuolar H+-ATPase C subunit (vatpc1 gene).144004395 (33)
JMFF015D01Sequence564004395 (33)gb:AJ843122_18145074e-55Plantago major mRNA for vacuolar H+-ATPase C subunit (vatpc1 gene).646004395 (33)sp|Q40585|VATL_TOBAC7e-53Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169
JMFF015I05Sequence559004395 (33)gb:AJ843122_18145071e-54Plantago major mRNA for vacuolar H+-ATPase C subunit (vatpc1 gene).636004395 (33)sp|Q40585|VATL_TOBAC4e-50Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169
JMFF016C14Sequence640004395 (33)sp|Q40585|VATL_TOBAC3e-58Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169675004395 (33)sp|Q40585|VATL_TOBAC4e-53Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169
JMFF024H21Sequence526004395 (33)gb:AJ843122_18145073e-49Plantago major mRNA for vacuolar H+-ATPase C subunit (vatpc1 gene).794004395 (33)sp|Q40585|VATL_TOBAC4e-58Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169
JMFF028E03Sequence547004395 (33)gb:AJ843122_18145071e-54Plantago major mRNA for vacuolar H+-ATPase C subunit (vatpc1 gene).666004395 (33)sp|Q40585|VATL_TOBAC2e-52Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169
JMFF028F03Sequence545004395 (33)gb:AJ843122_18145071e-54Plantago major mRNA for vacuolar H+-ATPase C subunit (vatpc1 gene).638004395 (33)sp|Q40585|VATL_TOBAC3e-50Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169
JMFF028K16Sequence510004395 (33)gb:AJ843122_18145073e-49Plantago major mRNA for vacuolar H+-ATPase C subunit (vatpc1 gene).690004395 (33)sp|Q40585|VATL_TOBAC6e-57Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169
JMFF034N11Sequence573004395 (33)sp|Q40585|VATL_TOBAC1e-57Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169697004395 (33)sp|Q40585|VATL_TOBAC4e-53Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169
JMFF037K18Sequence547004395 (33)gb:AJ843122_18145072e-44Plantago major mRNA for vacuolar H+-ATPase C subunit (vatpc1 gene).649004395 (33)sp|Q40585|VATL_TOBAC3e-45Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169
JMFF043F18Sequence619004395 (33)sp|Q40585|VATL_TOBAC2e-58Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169697004395 (33)gb:GHU13670_16801462e-08Gossypium hirsutum vacuolar H+-ATPase proteolipid (16 kDa) subunit (cva16-4) mRN
JMFN013L12Sequence644004395 (33)sp|Q40585|VATL_TOBAC3e-58Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169
JMSF002C22Sequence326004395 (33)gb:AJ843122_18145079e-29Plantago major mRNA for vacuolar H+-ATPase C subunit (vatpc1 gene).681004395 (33)sp|Q40585|VATL_TOBAC2e-57Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169
JMSF020L06Sequence671004395 (33)sp|Q40585|VATL_TOBAC3e-58Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169710004395 (33)sp|Q40585|VATL_TOBAC5e-56Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169
JMSF038P11Sequence663004395 (33)sp|Q40585|VATL_TOBAC3e-58Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169798004395 (33)sp|Q40585|VATL_TOBAC4e-58Vacuolar ATP synthase 16 kDa proteolipid subunit (EC 3.6.3.14).>gb:NTSUVTATP_169

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF043F18- TTTTTTTTTTTTTTTCXXXX
                      ____________________________________________________________
consensus TTTTTTTTTTTTTTTCNNNN
 
. : . : . : . : . : . :
rJMFF043F18- XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXGACCAAAAAATTTTAT
                      ____________________________________________________________
consensus NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACCAAAAAATTTTAT
 
. : . : . : . : . : . :
rJMFF043F18- CCAAATAACTTTAACCTTGGAAAAAGTTTGAGTAAAATAATACAGGCAATCCATTTTGGC
rJMFF028E03- ACTTTAACCTTGGAAAAAGTTTGAGTAAAATAATACAGGCAATCCATTCTGGT
rJMFF028K16- ACTTTAACCTTGG-AAAAGTTTGAGTAAAATAATACAGGCAATCCATTCTGGT
rJMFF034N11- ACTTTAACCTTGGAAAAAGTTTGAGTAAAATAATACAGGCAATCCATTCTGGT
rJMSF020L06- AAAGTTTGAGT-AAATAATACAGGCAATCCATTCTGGT
rJMFF016C14- GTTTGAGTAAAATAATACAGGCAATCCATTCTGGT
rJMFF009A06- TTGAGTAAAATAATACAGGCAATCCATTCTGGT
rJMSF002C22- AAAGTTTGAGT-AAATAATACAGGCAATCCATTCTGGT
rJMFF009A17- GT
rJMFF002J22- AAAAGTTTGAGTAAAATAATACAGGCAATCCATTCTGGT
rJMFF037K18- AGTAAAATAATACAGGCAATCCATTCTGGT
rJMFF024H21- TTTGAGTAAAATAATACAGGCAATCCATTCTGGT
rJMFF028F03- TTGAGTAAAATAATACAGGCAATCCATTCTGGT
rJMFF015I05- AAATAATACAGGCAATCCATTCTGGT
rJMFF015D01- TTTGAGTAAAATAATACAGGCAATCCATTCTGGT
rJMSF038P11- AAGTTTGAGTAAAATAATACAGGCAATCCATTCTGGT
                      ____________________________________________________________
consensus CCAAATAACTTTAACCTTGGAAAAAGTTTGAGTAAAATAATACAGGCAATCCATTCTGGT
 
. : . : . : . : . : . :
rJMFF043F18- CCCAAAAAAATACAACAGCAAAAAACCTGAGTTTTATTTGAGGAAAAACCTAATCTACAA
rJMFF028E03- CCCAGAAAAATACAACAGCAGAATACCTGAGTTTTATTTGAGGAGAGACCTAATCTACAA
rJMFF028K16- CCCAGAAAAATACAACAGCAGAATACCTGAGTTTTATTTGAGGAGAGACCTAATCTACAA
rJMFF034N11- CCCAGAAAAATACAACAGCAGAATACCTGAGTTTTATTTGAGGAGAGACCTAATCTACAA
rJMSF020L06- CCCAGAAAAATACAACAGCAGAATACCTGAGTTTTATTTGAGGAGAGACCTAATCTACAA
rJMFF016C14- CCCAGAAAAATACAACAGCAGAATACCTGAGTTTTATTTGAGGAGAGACCTAATCTACAA
rJMFF009A06- CCCAGAAAAATACAACAGCAGAATACCTGAGTTTTATTTGAGGAGAGACCTAATCTACAA
rJMSF002C22- CCCAGAAAAATACAACAGCAGAATACCTGAGTTTTATTTGAGGAGAGACCTAATCTACAA
rJMFF009A17- CCCAGAAAAATACAACAGCAGAATACCTGAGTTTTATTTGAGGAGAGACCTAATCTACAA
rJMFF002J22- CCCAGAAAAATACAACAGCAGAATACCTGAGTTTTATTTGAGGAGAGACCTAATCTACAA
rJMFF037K18- CCCAGAAAAATACAACAGCAGAATACCTGAGTTTTATTTGAGGAGAGACCTAATCTACAA
rJMFF024H21- CCCAGAAAAATACAACAGCAGAATACCTGAGTTTTATTTGAGGAGAGACCTAATCTACAA
rJMFF028F03- CCCAGAAAAATACGACAGCAGAATACCTGAGTTTTATTTGAGGAGAGACCTAATCTACAA
rJMFF015I05- CCCAGAAAAATACAACAGCAGAATACCTGAGTTTTATTTGAGGAGAGACCTAATCTACAA
rJMFF015D01- CCCAGAAAAATACAACAGCAGAATACCTGAGTTTTATTTGAGGAGAGACCTAATCTACAA
rJMSF038P11- CCCAGAAAAATACAACAGCAGAATACCTGAGTTTTATTTGAGGAGAGACCTAATCTACAA
                      ____________________________________________________________
consensus CCCAGAAAAATACAACAGCAGAATACCTGAGTTTTATTTGAGGAGAGACCTAATCTACAA
 
. : . : . : . : . : . :
rJMFF043F18- AAGCAAATCTTCCCATATGAACCAGTTGTTCTAGCCAAGCAATTAACCCCCCTAATCTTG
rJMFF028E03- AAGCAAATCATCACATATGAACCAGTTGTTCTAGCCAAGCAATTAACACACATAATCTTG
rJMFF028K16- AAGCAAATCATCACATATGAACCAGTTGTTCTAGCCAAGCAATTAACACACATAATCTTG
rJMFF034N11- AAGCAAATCATCACATATGAACCAGTTGTTCTAGCCAAGCAATTAACACACATAATCTTG
rJMSF020L06- AAGCAAATCATCACATATGAACCAGTTGTTCTAGCCAAGCAATTAACACACATAATCTTG
rJMFF016C14- AAGCAAATCATCACATATGAACCAGTTGTTCTAGCCAAGCAATTAACACACATAATCTTG
rJMFF009A06- AAGCAAATCATCACATATGAACCAGTTGTTCTAGCCAAGCAATTAACACACATAATCTTG
rJMSF002C22- AAGCAAATCATCACATATGAACCAGTTGTTCTAGCCAAGCAATTAACACACATAATCTTG
rJMFF009A17- AAGCAAATCATCACATATGAACCAGTTGTTCTAGCCAAGNAATTAACACACATAATCTTG
rJMFF002J22- AAGCAAATCATCACATATGAACCAGTTGTTCTAGCCAAGCAATTAACACACATAATCTTG
JMSF020L06+ TTCTAGCCAAGCAATTAACACACATAATCTTG
rJMFF037K18- AAGCAAATCATCACATATGAACCAGTTGTTCTAGCCAAGCAATTAACACACATAATCTTG
JMFF016C14+ TG
JMFN013L12+ CACATAATC-TG
rJMFF024H21- AAGCAAATCATCACATATGAACCAGTTGTTCTAGCCAAGCAATTAACACACATAATCTTG
rJMFF028F03- AAGCAAATCATCACATATGAACCAGTTGTTCTAGCCAAGCAATTAACACACATAATCTTG
rJMFF015I05- AAGCAAATCATCACATATGAACCAGTTGTTCTAGCCAAGCAATTAACACACATAATCTTG
rJMFF015D01- AAGCAAATCATCACATATGAACCAGTTGTTCTAGCCAAGCAATTAACACACATAATCTTG
rJMSF038P11- AAGCAAATCATCACATATGAACCAGTTGTTCTAGCCAAGCAATTAACACACATAATCTTG
JMSF038P11+ GCAATTAACACACATAATCTTG
                      ____________________________________________________________
consensus AAGCAAATCATCACATATGAACCAGTTGTTCTAGCCAAGCAATTAACACACATAATCTTG
 
. : . : . : . : . : . :
rJMFF043F18- GACCCAAAAAATAAAGAAAA-----ATTAAATAAAATAAAATGGGCCTGAAAAAAATTCA
rJMFF028E03- GACCAAAAGAATAAAGAAAA-----ATAAAATAAAATAAAATGTGCCTGAAGATAATTCA
rJMFF028K16- GACCAAAAGAATAAAGAAAA-----ATAAAATAAAATAAAATGTGCCTGAAGATAATTCA
rJMFF034N11- GACCAAAAGAATAAAGAAAA-----ATAAAATAAAATAAAATGTGCCTGAAGATAATTCA
rJMSF020L06- GACCAAAAGAATAAAGAAAA-----ATAAAATAAAATAAAATGTGCCTGAAGATAATTCA
rJMFF016C14- GACCAAAAGAATAAAGAAAA-----ATAAAATAAAATAAAATGTGCCTGAAGATAATTCA
rJMFF009A06- GACCAAAAGAATAAAGAAAA-----ATAAAATAAAATAAAATGTGCCTGAAGATAATTCA
rJMSF002C22- GACCAAAAGAATAAAGAAAAATAAAATAAAATAAAATAAAATGTGCCTGAAGATAATTCA
rJMFF009A17- GACCAAAAGAATAAAGAAAA-----AT
rJMFF002J22- GACCAAAAGAATAAAGAAAA-----ATAAAATAAAATAAAATGTGCCTGAAGATAATTCA
JMSF020L06+ GACCAAAAGAATAAAGAAAA-----ATAAAATAAAATAAAATGTGCCTGAAGATAATTCA
rJMFF037K18- GACCAAAAGAATAAAGAAAA-----ATAANATAAAATAAAATGTGCCTGAAGATAATTCA
JMFF043F18+ GAAAA-----ATAAAATAATATAAAATGTGCCGGAAGATAATTCA
JMFF016C14+ GACCAAAAGAATAAAGAAAA-----ATAAAATAAAATAAAATGTGCCTGAAGATAATTCA
JMFN013L12+ GNCCAAAAGAATAAAGAAAA-----ATAAAATAAAATANAATGTGCCTGAAGATAATTCA
rJMFF024H21- GACCAAAAGAATAAAGAAAA-----ATAAAATAAAATAAAATGTGCCTGAAGATAATTCA
rJMFF028F03- GACCAAAAGAATAAAGAAAA-----ATAAAATAAAATAAAATGTGCCTGAAGATAATTCA
rJMFF015I05- GACCAAAAGAATAAAGAAAA-----ATAAAATAAAATAAAATGTGCCTGAAGATAATTCA
rJMFF015D01- GACCAAAAGAATAAAGAAAA-----ATAAAATAAAATAAAATGTGCCTGAAGATAATTCA
rJMSF038P11- GACCAAAAGAATAAAGAAAA-----ATAAAATAAAATAAAATGTGCCTGAAGATAATTCA
JMSF038P11+ GACCAAAAGAATAAAGAAAA-----ATAAAATAAAATAAAATGTGCCTGAAGATAATTCA
                      ____________________________________________________________
consensus GACCAAAAGAATAAAGAAAA-----ATAAAATAAAATAAAATGTGCCTGAAGATAATTCA
 
. : . : . : . : . : . :
rJMFF043F18- AATCTGTTCTTCGTCTACTCGGCTCTAAATTGACCCCCACCAAAAAAAAGGATGATTCC-
rJMFF028E03- AATCTGTTCTTCGTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
rJMFF028K16- AATCTGTTCTTCGTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
rJMFF034N11- AATCTGTTCTTCGTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
rJMSF020L06- AATCTGTTCTTCGTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
rJMFF016C14- AATCTGTTCTTCGTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
rJMFF009A06- AATCTGTTCTTCGTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
rJMSF002C22- AATCTGTTCTTCGTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
rJMFF002J22- AATCTGTTCTTCGTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
JMSF020L06+ AATCTGTTCTTCGTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
rJMFF037K18- AATCTGTTCTTCGTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
JMFF043F18+ AATCTGTTCGTCGTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
JMFF016C14+ AATCTGTTCTTCGTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
JMFN013L12+ AATCTGTTCTTCGTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
JMFF028E03+ GCACGAGAAGAGAGGATGATTCC-
rJMFF024H21- AATCTGTTCTTCGTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
rJMFF028F03- AATCTGTTCTTCGTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
rJMFF015I05- AATCTGTTCTTCGTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
rJMFF015D01- AATCTGTTCTTCGTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
JMFF034N11+ GTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
JMFF037K18+ ACGAGAAGAGAGGATGATTNC-
rJMSF038P11- AATCTGTTCTTCGTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
JMSF038P11+ AATCTGTTCTTCGTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
JMFF028F03+ ACGAGAAGAGAGGATGATTCC-
JMFF015I05+ ACGAGAAGAGAGGATGATTCC-
JMFF015D01+ CCAGCACGAGAAGAGAGGATGATTCC-
JMFF009A06+ TTGACCAGCACGAGAAGAGAGGATGATTCCG
                      ____________________________________________________________
consensus AATCTGTTCTTCGTCTACTCGGCTCTAGATTGACCAGCACGAGAAGAGAGGATGATTCC-
 
. : . : . : . : . : . :
rJMFF043F18- GACAATAAGGCCATAAAGGGCCAAAACTTCCGCGAAAATGAAAATGAAAATCCTCCCCAC
rJMFF028E03- GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
rJMFF028K16- GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
rJMFF034N11- GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
rJMSF020L06- GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
rJMFF016C14- GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
rJMFF009A06- GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
rJMSF002C22- GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
rJMFF002J22- GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
JMSF020L06+ GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
rJMFF037K18- GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
JMFF043F18+ GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
JMFF016C14+ GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
JMFN013L12+ GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
JMFF028E03+ GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
rJMFF024H21- GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
rJMFF028F03- GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
rJMFF015I05- GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
rJMFF015D01- GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
JMFF034N11+ GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
JMFF037K18+ GACAATAAGGCCATAAAGTGCCAGAGCTTCAGNGAAAATGAGAATGAGAATCATCCCAAC
rJMSF038P11- GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
JMSF038P11+ GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
JMFF028F03+ GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
JMFF015I05+ GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
JMFF015D01+ GACAATAAGNCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
JMFF009A06+ GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
JMFF024H21+ ATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
JMFF028K16+ ATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
JMFF002J22+ GGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
                      ____________________________________________________________
consensus GACAATAAGGCCATAAAGTGCCAGAGCTTCAGCGAAAATGAGAATGAGAATCATCCCAAC
 
. : . : . : . : . : . :
rJMFF043F18- AAAAAATTTGGGCTGGTGGGCATTAACTCTAAAACCGGGGTCCCCCACAATGCCAATTGC
rJMFF028E03- AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
rJMFF028K16- AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
rJMFF034N11- AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
rJMSF020L06- AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
rJMFF016C14- AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
rJMFF009A06- AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
rJMSF002C22- AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
rJMFF002J22- AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
JMSF020L06+ AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
rJMFF037K18- AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
JMFF043F18+ AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
JMFF016C14+ AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
JMFN013L12+ AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
JMFF028E03+ AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
rJMFF024H21- AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
rJMFF028F03- AAAGAGCTTGGGCTGTTGTGCATTANCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
rJMFF015I05- AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
rJMFF015D01- AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
JMFF034N11+ AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
JMFF037K18+ AAAGAGCTTGGGCTGTTGTGCATTAGCTNTAACACCGGCGTCCCCCACAATGCCGATTGC
rJMSF038P11- AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
JMSF038P11+ AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
JMFF028F03+ AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
JMFF015I05+ AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
JMFF015D01+ AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
JMFF009A06+ AAAGAGCTTGGGCTGTTGTGCATTAGCTNTAACACCGGCGTCCCCCACAATGCCGATTGC
JMFF024H21+ AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
JMFF028K16+ AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
JMFF002J22+ AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
                      ____________________________________________________________
consensus AAAGAGCTTGGGCTGTTGTGCATTAGCTCTAACACCGGCGTCCCCCACAATGCCGATTGC
 
. : . : . : . : . : . :
rJMFF043F18- CATACCGGCAAAAAGGCCACCAAGGCCCCAAGCAAAACCCGAAGAAAGGGGAGCCTAGCC
rJMFF028E03- CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
rJMFF028K16- CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
rJMFF034N11- CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
rJMSF020L06- CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
rJMFF016C14- CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
rJMFF009A06- CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
rJMSF002C22- CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
rJMFF002J22- CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
JMSF020L06+ CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
rJMFF037K18- CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
JMFF043F18+ CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
JMFF016C14+ CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
JMFN013L12+ CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
JMFF028E03+ CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
rJMFF024H21- CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
rJMFF028F03- CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
rJMFF015I05- CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
rJMFF015D01- CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
JMFF034N11+ CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
JMFF037K18+ CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
rJMSF038P11- CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
JMSF038P11+ CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
JMFF028F03+ CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
JMFF015I05+ CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
JMFF015D01+ CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
JMFF009A06+ CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
JMFF024H21+ CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
JMFF028K16+ CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
JMFF002J22+ CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
                      ____________________________________________________________
consensus CATACCGGCAGAAAGGCCAGCAAGGCCACAAGCAAGACCCGAGGAAAGGTGAGCATAGCC
 
. : . : . : . : . : . :
rJMFF043F18- CTCAAAGA-AAAGTAC-AATTGGCCTTGGGGTTGATCCCGGTACTGATGATCAC-CCGAT
rJMFF028E03- ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
rJMFF028K16- ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
rJMFF034N11- ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
rJMSF020L06- ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
rJMFF016C14- ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
rJMFF009A06- ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
rJMSF002C22- ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
rJMFF002J22- ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
JMSF020L06+ ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
rJMFF037K18- ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
JMFF043F18+ ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
JMFF016C14+ ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
JMFN013L12+ ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
JMFF028E03+ ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
rJMFF024H21- ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
rJMFF028F03- ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
rJMFF015I05- ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
rJMFF015D01- ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
JMFF034N11+ ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
JMFF037K18+ ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
rJMSF038P11- ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
JMSF038P11+ ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
JMFF028F03+ ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
JMFF015I05+ ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
JMFF015D01+ ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
JMFF009A06+ ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
JMFF024H21+ ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
JMFF028K16+ ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
JMFF009A17+ GGGTTGATCCCGGTACTGATGATCACAGCGAT
JMFF002J22+ ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
JMSF002C22+ GATCCCGGTACTGATGATCACAGCGAT
                      ____________________________________________________________
consensus ATCAAAGAGATAGTACGATTTGGTCTTGGGGTTGATCCCGGTACTGATGATCACAGCGAT
 
. : . : . : . : . : . :
rJMFF043F18- AAT-AATCCGTAAATACCTAAC
rJMFF028E03- AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
rJMFF028K16- AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
rJMFF034N11- AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
rJMSF020L06- AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
rJMFF016C14- AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
rJMFF009A06- AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
rJMSF002C22- AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
rJMFF002J22- AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
JMSF020L06+ AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
rJMFF037K18- AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
JMFF043F18+ AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
JMFF016C14+ AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
JMFN013L12+ AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
JMFF028E03+ AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
rJMFF024H21- AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
rJMFF028F03- AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
rJMFF015I05- AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
rJMFF015D01- AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
JMFF034N11+ AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
JMFF037K18+ AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
rJMSF038P11- AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
JMSF038P11+ AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
JMFF028F03+ AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
JMFF015I05+ AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
JMFF015D01+ AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
JMFF009A06+ AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
JMFF024H21+ AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
JMFF028K16+ AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
JMFF009A17+ AATCAATCCGTAAATACNTANCACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
JMFF002J22+ AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
JMSF002C22+ AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
                      ____________________________________________________________
consensus AATCAATCCGTAAATACCTAACACACCAGCCATAACCACCGGCACAATCGACTTCATCAC
 
. : . : . : . : . : . :
rJMFF028E03- CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
rJMFF028K16- CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
rJMFF034N11- CAGCTCCGGCCTCATCTCACCCATCGACGCCACACCTACCCCGGCTCTTCGCGGTCCCGT
rJMSF020L06- CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
rJMFF016C14- CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCCGGCTCTTCGCGGTCCCGT
rJMFF009A06- CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCCGGCTCTTCGCGGTCCCGT
rJMSF002C22- CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
rJMFF002J22- CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCCGGCTCTTCGCGGTCCCGT
JMSF020L06+ CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
rJMFF037K18- CAGCTCCGGCCTCATCACACCCACCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
JMFF043F18+ CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
JMFF016C14+ CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
JMFN013L12+ CAGCTCCGGCCTCATCACACCCATCGAGGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
JMFF028E03+ CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
rJMFF024H21- CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
rJMFF028F03- CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
rJMFF015I05- CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
rJMFF015D01- CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
JMFF034N11+ CAGCTCCGGCCTCATCTCACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
JMFF037K18+ CAGCTCCGGCCTCATCACACCCACCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
rJMSF038P11- CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
JMSF038P11+ CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
JMFF028F03+ CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
JMFF015I05+ CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
JMFF015D01+ CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
JMFF009A06+ CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
JMFF024H21+ CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
JMFF028K16+ CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
JMFF009A17+ CAGCTCCGGCNTCATCACACCCATCGACGCCACACCTACCCC-GCTNTTCGCGGTCCCGT
JMFF002J22+ CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
JMSF002C22+ CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
                      ____________________________________________________________
consensus CAGCTCCGGCCTCATCACACCCATCGACGCCACACCTACCCC-GCTCTTCGCGGTCCCGT
 
. : . : . : . : . : . :
rJMFF028E03- AAGCAGCTCCCATACAGG
rJMFF028K16- AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGA
rJMFF034N11- AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAA
rJMSF020L06- AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
rJMFF016C14- AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAG
rJMFF009A06- AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGG
rJMSF002C22- AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAG
rJMFF002J22- AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
JMSF020L06+ AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
rJMFF037K18- AAGCAGCTCCCATACAGGAGAAGACT
JMFF043F18+ AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
JMFF016C14+ AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
JMFN013L12+ AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
JMFF028E03+ AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
rJMFF024H21- AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
rJMFF028F03- AAGCAGCTCCCA
rJMFF015I05- AAGCAGCTC
rJMFF015D01- AAGCAGCTCCCATACAGGA
JMFF034N11+ AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
JMFF037K18+ AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
rJMSF038P11- AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
JMSF038P11+ AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
JMFF028F03+ AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
JMFF015I05+ AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
JMFF015D01+ AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
JMFF009A06+ AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
JMFF024H21+ AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
JMFF028K16+ AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
JMFF009A17+ AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCNCCGAGGAAGCNGAAGAACG
JMFF002J22+ AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
JMSF002C22+ AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
                      ____________________________________________________________
consensus AAGCAGCTCCCATACAGGAGAAGACTAGGGCGGCCGCAGCGCCGAGGAAGCCGAAGAACG
 
. : . : . : . : . : . :
rJMSF020L06- GCGCCGTTTCATCTCCGCTG
rJMFF002J22- GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGCTTTTGTCGATCGCGGAT
JMSF020L06+ GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGCTTTTGTCGATCGCGGAT
JMFF043F18+ GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGCTTTTGTCGATCGCGGAT
JMFF016C14+ GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGCTTTTGTCGATCGCGGAT
JMFN013L12+ GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGCTTTTGTCGATCGCGGAT
JMFF028E03+ GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGCTTTTGTCGATCGCGGAT
rJMFF024H21- GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGCTTTTGTCGATCGCGGAT
JMFF034N11+ GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGCTTTTGTCGATCGCGGAT
JMFF037K18+ GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGCTTTTGTCGATCGCGGAT
rJMSF038P11- GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGCTTTTGTCGATCGCGGAT
JMSF038P11+ GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGCTTTTGTCGATCGCGGAT
JMFF028F03+ GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGCTTTTGTCGATCGCGGAT
JMFF015I05+ GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGCTTTTGTCGATCGCGGAT
JMFF015D01+ GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGCTTTTGTCGATCGCGGAT
JMFF009A06+ GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGCTTTTGTCGATCGCGGAT
JMFF024H21+ GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGCTTTTGTCGATCGCGGAT
JMFF028K16+ GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGCTTTTGTCGATCGCGGAT
JMFF009A17+ GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGNTTTTGTCGATAGCGGAT
JMFF002J22+ GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGCTTTTGTCGATCGCGGAT
JMSF002C22+ GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGCTTTTGTCGATCGCGGAT
                      ____________________________________________________________
consensus GCGCCGTTTCATCTCCGCTGAAGGTTGAAGACATCTTCTCAGCTTTTGTCGATCGCGGAT
 
. : . : . : . : . : . :
rJMFF002J22- TTGATCGGATCTGAAAATCTCTCNTCTATGA
JMSF020L06+ TTGATCGGATCTGAAAATCTCTCTTCTATGATTTCCACTTTGCA
JMFF043F18+ TTGATCGGATCTGAAAATCTCTCTTCTATGATTTCCA
JMFF016C14+ TTGATCGGATCTGAAAATCTCTCTTCTATGATTTCCACTTT
JMFN013L12+ TTGATCGGATCTGAAAATCTCTCTTCTATGATTTCCACTT
JMFF028E03+ TTGATCGGATCTGAAAATCTCTCTTCTATGATTTCCACTTTGCAG
rJMFF024H21- TTGATCGGATCTGAAAATCTCTCTTCTATGATTTCCACTTTGCAGAG
JMFF034N11+ TTGATCGGATCTGAAAATCTCTCTTCTATGATTTCCACTTTGCAGAG
JMFF037K18+ TTGATCGGATCTGAAAATCTCTCTTCTATGATTTCCACTTTGCAGAG
rJMSF038P11- TTGATCGGATCTGAAAATCTCTCTTCTATGATTTCCACTTTGCAGAG
JMSF038P11+ TTGATCGGATCTGAAAATCTCTCTTCTATGATTTCCACTTTGCAGAG
JMFF028F03+ TTGATCGGATCTGAAAATCTCTCTTCTATGATTTCCACTTTGCAG
JMFF015I05+ TTGATCGGATCTGAAAATCTCTCTTCTATGATTTCCACTTTGCAGAGAGGGCACAGAAT
JMFF015D01+ TTGATCGGATCTGAAAATCTCTCTTCTATGATTTCCACTTTGCAGAGAGGGCACAGAAT
JMFF009A06+ TTGATCGGATCTGAAAATCTCTCTTCTATGATTTCCACTTTGCAGAGAGGGCACAGAAT
JMFF024H21+ TTGATCGGATCTGAAAATCTCTCTTCTATGATTTCCACTTTGCAGAGAGGGCACAGAAT
JMFF028K16+ TTGATCGGATCTGAAAATCTCTCTTCTATGATTTCCACTTTGC
JMFF009A17+ TTGATCGGATCTGAAAATCTNTCNTNTATGATTTCCACTTTGCAGAGAGGGCACAGAAT
JMFF002J22+ TTGATCGGATCTGAAAATCTCTCTTCTATGATTTCCACTTTGCAGAGAGGGCACAGAAT
JMSF002C22+ TTGATCGGATCTGAAAATCTCTCTTCTATGATTTCCACTTTGCAGAGAGGGCACAGAATC
                      ____________________________________________________________
consensus TTGATCGGATCTGAAAATCTCTCTTCTATGATTTCCACTTTGCAGAGAGGGCACAGAATC