Previous Contig 004390:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002B22Sequence325004390 (3)738011188 (3)gb:AY087786_15728133e-65Arabidopsis thaliana clone 38412 mRNA, complete sequence.
JMSF036O06Sequence641004390 (3)pir|D84766|D847663e-39hypothetical protein At2g35260 [imported] - Arabidopsis thaliana>gb:AC004667_153676011188 (3)gb:AY087786_15728138e-56Arabidopsis thaliana clone 38412 mRNA, complete sequence.
JMSF039G19Sequence622004390 (3)pir|D84766|D847661e-37hypothetical protein At2g35260 [imported] - Arabidopsis thaliana>gb:AC004667_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039G19+ CTCGAGCATGAGGCGATAGCTTCACA
JMSF036O06+ TCTAATGGCTCGAGCATGAGGCGATAGCTTCACA
                      ____________________________________________________________
consensus TCTAATGGCTCGAGCATGAGGCGATAGCTTCACA
 
. : . : . : . : . : . :
JMSF039G19+ ACTTCATCATCTAGTATAAATAGAAGGGCCATGATTGGAGGGGCCGCGTATCCCAACCCT
JMSF036O06+ ACTTCATCATCTAGTATAAATAGAAGGGCCATGATTGGAGGGGCCGCGTATCCCAACCCT
                      ____________________________________________________________
consensus ACTTCATCATCTAGTATAAATAGAAGGGCCATGATTGGAGGGGCCGCGTATCCCAACCCT
 
. : . : . : . : . : . :
JMSF039G19+ TCAACAATGGCATCTAACGTTGGCGTGAACCCTCCCGTACTATCTATTCCCGTCATCGAA
JMSF036O06+ TCAACAATGGCATCTAACGTTGGCGTGAACCCTCCCGTACTATCTATTCCCGTCATCGAA
                      ____________________________________________________________
consensus TCAACAATGGCATCTAACGTTGGCGTGAACCCTCCCGTACTATCTATTCCCGTCATCGAA
 
. : . : . : . : . : . :
JMSF039G19+ CATATAAACCTTCCAGCTAAAGCCATTGCACCATATATTCCGATTCCGTAGCTGAGACGC
JMSF036O06+ CATATAAACCTTCCAGCTAAAGCCATTGCACCATATATTCCGATTCCGTAGCTGAGACGC
                      ____________________________________________________________
consensus CATATAAACCTTCCAGCTAAAGCCATTGCACCATATATTCCGATTCCGTAGCTGAGACGC
 
. : . : . : . : . : . :
JMSF039G19+ ACGATTGCACCGATCTTGTCCCAGACGGGAAGTTCGGCTTCGCGGAAAGTCTGGTTGAGC
JMSF036O06+ ACGATTGCACCGATCTTGTCCCAGACGGGAAGTTCGGCTTCGCGGAAAGTCTGGTTGAGC
                      ____________________________________________________________
consensus ACGATTGCACCGATCTTGTCCCAGACGGGAAGTTCGGCTTCGCGGAAAGTCTGGTTGAGC
 
. : . : . : . : . : . :
JMSF039G19+ GTGGTGACCTCCATGGTGGGTCCGGCGAACGTCCCCGCAGCTCCGGCATCTCTCTCCGCT
JMSF036O06+ GTGGTGACCTCCATGGTGGGTCCGGCGAACGTCCCCGCAGCTCCGGCATCTCTCTCCGCT
                      ____________________________________________________________
consensus GTGGTGACCTCCATGGTGGGTCCGGCGAACGTCCCCGCAGCTCCGGCATCTCTCTCCGCT
 
. : . : . : . : . : . :
JMSF039G19+ GCTCCGCCTTCCACGGCGTCGCCGCCGGTTCTCTCCGCCGTCGCCTTGACTCTAACGACC
JMSF036O06+ GCTCCGCCTTCCACGGCGTCGCCGCCGGTTCTCTCCGCCGTCGCCTTGACTCTAACGACC
JMSF002B22+ CGCCGTCGCCTTGACTCTAACGACC
                      ____________________________________________________________
consensus GCTCCGCCTTCCACGGCGTCGCCGCCGGTTCTCTCCGCCGTCGCCTTGACTCTAACGACC
 
. : . : . : . : . : . :
JMSF039G19+ GCAATACCCGCCGTGGTGTTTTTCTTCTTCTTCTTGATGAAATTGACCGGGAATTCGTGA
JMSF036O06+ GCAATACCCGCCGTGGTGTTTTTCTTCTTCTTCTTGATGAAATTGACCGGGAATTCGTGA
JMSF002B22+ GCAATACCCGCCGTGGTGTTTTTCTTCTTCTTCTTGATGAAATTGACCGGGAATTCGTGA
                      ____________________________________________________________
consensus GCAATACCCGCCGTGGTGTTTTTCTTCTTCTTCTTGATGAAATTGACCGGGAATTCGTGA
 
. : . : . : . : . : . :
JMSF039G19+ AAGTTTCCGGCTTTGAAGAACGCGAGAGGGGGATTCGGAGCCCGGAATATCATCGGAAGC
JMSF036O06+ AAGTTTCCGGCTTTGAAGAACGCGAGAGGGGGATTCGGAGCCCGGAATATCATCGGAAGC
JMSF002B22+ AAGTTTCCGGCTTTGAAGAACGCGAGAGGGGGATTCGGAGCCCGGAATATCATCGGAAGC
                      ____________________________________________________________
consensus AAGTTTCCGGCTTTGAAGAACGCGAGAGGGGGATTCGGAGCCCGGAATATCATCGGAAGC
 
. : . : . : . : . : . :
JMSF039G19+ TCCATTTTTTTCGAGTGAGGTCCGGTCGGAGGTGTTTTACGGCCGGCGAGCTAATGTCGG
JMSF036O06+ TCCATTTTTTTCGAGTGAGGTCCGGTCGGAGGTGTTTTACGGCCGGCGAGCTAATGTCGG
JMSF002B22+ TCCATTTTTTTCGAGTGAGGTCCGGTCGGAGGTGTTTTACGGCCGGCGAGCTAATGTCGG
                      ____________________________________________________________
consensus TCCATTTTTTTCGAGTGAGGTCCGGTCGGAGGTGTTTTACGGCCGGCGAGCTAATGTCGG
 
. : . : . : . : . : . :
JMSF039G19+ GACTTTAACCTGCCGTTGATTCCCGTCCGGCTTCTTCTAAGCATGCTGTAATCC
JMSF036O06+ GACTTTAACCTGCCGTTGATTCCCGTCCGGCTTCTTCTAAGCATGCTGTAATCCAGTCTC
JMSF002B22+ GACTTTAACCTGCCGTTGATTCCCGTCCGGCTTCTTCTAAGCATGCTGTAATCCAGTCTC
                      ____________________________________________________________
consensus GACTTTAACCTGCCGTTGATTCCCGTCCGGCTTCTTCTAAGCATGCTGTAATCCAGTCTC
 
. : . : . : . : . : . :
JMSF036O06+ GCAAGC
JMSF002B22+ GCAAGCAAGAAGAAGAGATTTATATATAAATATATATAATATGATATGATATTGGCCGCC
                      ____________________________________________________________
consensus GCAAGCAAGAAGAAGAGATTTATATATAAATATATATAATATGATATGATATTGGCCGCC