Previous Contig 004386:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF002B08Sequence234004386 (2)
JMSF008A02Sequence278004386 (2)774022246gb:AY080843_15685365e-10Arabidopsis thaliana unknown protein (At5g67240) mRNA, complete cds.>gb:BT001977

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF008A02+ CAGGA
                      ____________________________________________________________
consensus CAGGA
 
. : . : . : . : . : . :
JMSF008A02+ AAAAGTGTTGTAGAATCGAACTTCTGAATTGTGCCCAGAGTGAGTTTGTGGGCAATGTTT
                      ____________________________________________________________
consensus AAAAGTGTTGTAGAATCGAACTTCTGAATTGTGCCCAGAGTGAGTTTGTGGGCAATGTTT
 
. : . : . : . : . : . :
JMSF008A02+ AGGAGTCTTCCTGCCGGACGGGGAGGTCAAGACGAGGCTTGCACCTGGGGGACAGCGGCT
JMSF002B08+ CTTCCTGCCGGACGGGGAGGTCAAGACGAGGCTTGCACCTGGGGGACAGCGGCT
                      ____________________________________________________________
consensus AGGAGTCTTCCTGCCGGACGGGGAGGTCAAGACGAGGCTTGCACCTGGGGGACAGCGGCT
 
. : . : . : . : . : . :
JMSF008A02+ GGCGAGGCAGAACTCTGGCGGACGGAGGTGAGGGAACTGATTGTCTGCTTACGGAGGTCG
JMSF002B08+ GGCGAGGCAGAACTCTGGCGGACGGAGGTGAGGGAACTGATTGTCTGCTTACGGAGGTCG
                      ____________________________________________________________
consensus GGCGAGGCAGAACTCTGGCGGACGGAGGTGAGGGAACTGATTGTCTGCTTACGGAGGTCG
 
. : . : . : . : . : . :
JMSF008A02+ GAGGCTGCGAATTGGCGTCTCGCCGCCTTTGGCTGGCGGCCGGCGGTCCTGGTGGATGGC
JMSF002B08+ GAGGCTGCGAATTGGCGTCTCGCCGCCTTTGGCTGGCGGCCGGCGGTCCTGGTGGATGGC
                      ____________________________________________________________
consensus GAGGCTGCGAATTGGCGTCTCGCCGCCTTTGGCTGGCGGCCGGCGGTCCTGGTGGATGGC
 
. : . : . : . : . : . :
JMSF008A02+ GAGGCTGAGGCAGTCAGGCAGAAAGCATTTT
JMSF002B08+ GAGGCTGAGGCAGTCAGGCAGAAAGCATTTTGAGATTTCAGAATAGGGTTTAGGGTTATC
                      ____________________________________________________________
consensus GAGGCTGAGGCAGTCAGGCAGAAAGCATTTTGAGATTTCAGAATAGGGTTTAGGGTTATC