Previous Contig 004373:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS040B06Sequence618004373 (3)gb:AY064012_15659523e-55Arabidopsis thaliana putative exonuclease (At1g54490) mRNA, complete cds.>gb:AY0
JMSF001P16Sequence248004373 (3)732011174 (2)
JMSF047A03Sequence609004373 (3)gb:AY064012_15659524e-46Arabidopsis thaliana putative exonuclease (At1g54490) mRNA, complete cds.>gb:AY0701011174 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS040B06+ ATCTCAAATTCTTTCN
                      ____________________________________________________________
consensus ATCTCAAATTCTTTCN
 
. : . : . : . : . : . :
JMFS040B06+ TCAATCTTTCTTCTTCAGCTTCAGCNTCAGTAGCATCTTTAGCAGCTCTGAAACGCCTAG
                      ____________________________________________________________
consensus TCAATCTTTCTTCTTCAGCTTCAGCNTCAGTAGCATCTTTAGCAGCTCTGAAACGCCTAG
 
. : . : . : . : . : . :
JMFS040B06+ TACGTTGTTGATTCATTTTAGCTCTAGGAGCCACTCCATCGATTGCCATATAAAGTAGCT
JMSF047A03+ CACTCCATCGATTGCCATATAAAGTAGCT
                      ____________________________________________________________
consensus TACGTTGTTGATTCATTTTAGCTCTAGGAGCCACTCCATCGATTGCCATATAAAGTAGCT
 
. : . : . : . : . : . :
JMFS040B06+ TTCTAGGACGAACTAATGAGAAAAGATGGTCAATGTACTCAAAAATTGATTTGAATACAT
JMSF047A03+ TTCTAGGACGAACTAATGAGAAAAGATGGTCAATGTACTCAAAAATTGATTTGAATACAT
                      ____________________________________________________________
consensus TTCTAGGACGAACTAATGAGAAAAGATGGTCAATGTACTCAAAAATTGATTTGAATACAT
 
. : . : . : . : . : . :
JMFS040B06+ CATCATAAGTGGCAGGTGCAGGCTTGCCTTCTGGGTGAAAACAAGGGTGAATAATCCCAT
JMSF047A03+ CATCATAAGTGGCAGGTGCAGGCTTGCCTTNTGGGTGAAAACAAGGGTGAATANTCCCAT
                      ____________________________________________________________
consensus CATCATAAGTGGCAGGTGCAGGCTTGCCTTCTGGGTGAAAACAAGGGTGAATAATCCCAT
 
. : . : . : . : . : . :
JMFS040B06+ TCATGTCCAGATACAAGTTATCAAACTCCATACCATTAGGGTTCGGCCTAGACACATCTA
JMSF047A03+ TCATGTCCAGATACAAGTTATCAAACTCCATACCATTAGGGTTCGGCCTAGACACATCTA
                      ____________________________________________________________
consensus TCATGTCCAGATACAAGTTATCAAACTCCATACCATTAGGGTTCGGCCTAGACACATCTA
 
. : . : . : . : . : . :
JMFS040B06+ TTGACGAAGGCACCCGGTTCTCACCCTCCCTTGGCTCTTCCTCCACCACGTCAGCAATCG
JMSF047A03+ TTGACGAAGGCACCCGGTTCTCACCCTCCCTTGGCTCTTCCTCCACCACGTCAGCAATCG
                      ____________________________________________________________
consensus TTGACGAAGGCACCCGGTTCTCACCCTCCCTTGGCTCTTCCTCCACCACGTCAGCAATCG
 
. : . : . : . : . : . :
JMFS040B06+ ACAGCGGGTACCGATCTGCCAGCCATCTATAAAATGCAGGCACTCCCATTTCTCCTCCTT
JMSF047A03+ ACAGCGGGTANCGATCTGCCAGCCATNTATAAAATGCAGGCACTCCCATTTCTCNTCCTT
                      ____________________________________________________________
consensus ACAGCGGGTACCGATCTGCCAGCCATCTATAAAATGCAGGCACTCCCATTTCTCCTCCTT
 
. : . : . : . : . : . :
JMFS040B06+ AACCACCGATGGCTTTAGCAGAACCCCACCTCTCTCTGTATGAATACCCAGATCGAAAAG
JMSF047A03+ AACCACCGATGGCTTTAGCAGAACCCCACCTCTCTCTGTATGAATACCCAGATCGAAAAG
JMSF001P16+ TCGAAAAG
                      ____________________________________________________________
consensus AACCACCGATGGCTTTAGCAGAACCCCACCTCTCTCTGTATGAATACCCAGATCGAAAAG
 
. : . : . : . : . : . :
JMFS040B06+ CAGAGTTTGATTCAAAAGTTGGCTTCAAGAAATCATAAATTATATTGCACCGTGTACTGT
JMSF047A03+ CAGAGTTTGATTCAAAAGTTGGCTTCAAGAANTCATAAATTATATTGCACCGTGTACTGT
JMSF001P16+ CAGAGTTTGATTCAAAAGTTGGCTTCAAGAAATCATAAATTATATTGCACCGTGTACTGT
                      ____________________________________________________________
consensus CAGAGTTTGATTCAAAAGTTGGCTTCAAGAAATCATAAATTATATTGCACCGTGTACTGT
 
. : . : . : . : . : . :
JMFS040B06+ ATGTTATATCTCTATGCGTTTGTATAGAAAGGTTTCAGAGACCGAAGAAAAAAGAGGGTT
JMSF047A03+ ATGTTATATCTCTATGCGTNNGTATAGAAAGGTTTCAGAGACCGAAGAAAAAAGAGGGTT
JMSF001P16+ ATGTTATATCTCTATGCGTTTGTATAGAAAGGTTTCAGAGACCGAAGAAAAAAGAGGGTT
                      ____________________________________________________________
consensus ATGTTATATCTCTATGCGTTTGTATAGAAAGGTTTCAGAGACCGAAGAAAAAAGAGGGTT
 
. : . : . : . : . : . :
JMFS040B06+ GA
JMSF047A03+ GAGGAGTAGTTGAAGAAGAGAGAGAATGGTCAATTCGGCGGAGTGTAAACAAGCAAAACA
JMSF001P16+ GAGGAGTAGTTGAAGAAGAGAGAGAATGGTCAATTCGGCGGAGTGTAAACAAGCAAAACA
                      ____________________________________________________________
consensus GAGGAGTAGTTGAAGAAGAGAGAGAATGGTCAATTCGGCGGAGTGTAAACAAGCAAAACA
 
. : . : . : . : . : . :
JMSF047A03+ CGACCCTGGAAATTCNGGAGTTGTANGGAGCACTGATGGG
JMSF001P16+ CGACCCTGGAAATTCTGGAGTTGTACGGAGCACTGATGGGCTGCGATGTACAAGCGTACC
                      ____________________________________________________________
consensus CGACCCTGGAAATTCTGGAGTTGTACGGAGCACTGATGGGCTGCGATGTACAAGCGTACC