Previous Contig 004367:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016K19Sequence545004367 (7)gb:AF030879_17625133e-39Solanum tuberosum protein kinase CPK1 mRNA, complete cds.792002476 (6)gb:AF030879_17625132e-68Solanum tuberosum protein kinase CPK1 mRNA, complete cds.
JMFF044B11Sequence620004367 (7)gb:AF030879_17625131e-24Solanum tuberosum protein kinase CPK1 mRNA, complete cds.623009558 (8)gb:CAR299062_16452355e-50Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can183.
JMFF047J14Sequence619004367 (7)gb:AF030879_17625137e-21Solanum tuberosum protein kinase CPK1 mRNA, complete cds.593002476 (6)gb:AF435451_17998313e-40Nicotiana tabacum calcium-dependent protein kinase CPK4 mRNA, complete cds.
JMFS154H10Sequence619004367 (7)gb:AF030879_17625134e-32Solanum tuberosum protein kinase CPK1 mRNA, complete cds.
JMSF001P02Sequence331004367 (7)678002476 (6)gb:AF030879_17625133e-44Solanum tuberosum protein kinase CPK1 mRNA, complete cds.
JMSF016M18Sequence481004367 (7)gb:AF030879_17625130.037Solanum tuberosum protein kinase CPK1 mRNA, complete cds.780002476 (6)gb:AF435451_17998313e-74Nicotiana tabacum calcium-dependent protein kinase CPK4 mRNA, complete cds.
JMSF025L19Sequence361004367 (7)763008895 (7)pir|T52451|T524512e-67endopeptidase Clp chain P extended inactive homolog clpP5 [similarity] - Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF016K19+ ACCAGTTAAGGCCTTTAATATTTTGACTTCTCGCTTGACATCCT
                      ____________________________________________________________
consensus ACCAGTTAAGGCCTTTAATATTTTGACTTCTCGCTTGACATCCT
 
. : . : . : . : . : . :
JMFF016K19+ CAACTGCCATGGGAAGAAGCATCTTCTTCTTCTCGATTCTTTTAACAGCAACTCGATCTC
JMFS154H10+ CAACTGCCATGGGAAGAAGCATCTTCTTCTTCTCGATTCTTTTAACAGCAACTCGATCTC
JMFF044B11+ CAGCAACTCGATCTC
                      ____________________________________________________________
consensus CAACTGCCATGGGAAGAAGCATCTTCTTCTTCTCGATTCTTTTAACAGCAACTCGATCTC
 
. : . : . : . : . : . :
JMFF016K19+ CAACAGACTTGTCAGTAGCAACATAAGTGTATCCAAATTGACCATGTCCCAACAACTTGC
JMFS154H10+ CAACAGACTTGTCAGTAGCAACATAAGTGTATCCAAATTGACCATGTCCCAACAACTTGC
JMFF044B11+ CAACAGACTNGTCAGTAGCAACATAAGTGTATCCAAATTGACCATGTCCCAACAACTTGC
JMFF047J14+ TCAGTAGCAACATAAGTGTATCCAAATTGACCATGTCCCAACAACTTGC
                      ____________________________________________________________
consensus CAACAGACTTGTCAGTAGCAACATAAGTGTATCCAAATTGACCATGTCCCAACAACTTGC
 
. : . : . : . : . : . :
JMFF016K19+ CAATTGTATACCGCTTATCAAAATCCTTATCATACCCAAAATCCGTTCTTTTCCCGCAAG
JMFS154H10+ CAATTGTATACCGCTTATCAAAATCCTTATCATACCCAAAATCCGTTCTTTTCCCGCAAG
JMSF016M18+ TCCGTTCTTTTCCCGCAAG
JMFF044B11+ CAATTGTATACCGCTTATCAAAATCCTTATCATACCCAAAATCCGTTCTTTTCCCGCAAG
JMFF047J14+ CAATTGTATACCGCTTATCAAAATCCTTATCATACCCAAAATCCGTTCTTTTCCCGCAAG
                      ____________________________________________________________
consensus CAATTGTATACCGCTTATCAAAATCCTTATCATACCCAAAATCCGTTCTTTTCCCGCAAG
 
. : . : . : . : . : . :
JMFF016K19+ GGATAACCACAGTTTGACTCCTGTGACTGGGCTTAACATTTAAATTCTTATATTTCTCGC
JMFS154H10+ GGATAACCACAGTTTGACTCCTGTGACTGGGCTTAACATTTAAATTCTTATATTTCTCGC
JMSF016M18+ GGATAACCACAGTTTGACTCCTGTGACTGGGCTTAACATTTAAATTCTTATATTTCTCGC
JMFF044B11+ GGATAACCACAGTTTGACTCCTGTGACTGGGCTTAACATTTAAATTCTTATATTTCTCGC
JMFF047J14+ GGATAACCACAGTTTGACTCCTGTGACTGGGCTTAACATTTAAATTCTTATATTTCTCGC
                      ____________________________________________________________
consensus GGATAACCACAGTTTGACTCCTGTGACTGGGCTTAACATTTAAATTCTTATATTTCTCGC
 
. : . : . : . : . : . :
JMFF016K19+ ATGGTTCTTTAGCCTTCCTTCGATTACAACGTGATCTCTCCTCATCTTGTGCTGATGTGG
JMFS154H10+ ATGGTTCTTTAGCCTTCCTTCGATTACAACGTGATCTCTCCTCATCTTGTGCTGATGTGG
JMSF016M18+ ATGGTTCTTTAGCCTTCCTTCGATTACAACGTGATCTCTCCTCATCTTGTGCTGATGTGG
JMSF025L19+ CCTCATCTTGTGCTGATGTGG
JMFF044B11+ ATGGTTCTTTAGCCTTCCTTCGATTACAACGTGATCTCTCCTCATCTTGTGCTGATGTGG
JMFF047J14+ ATGGTTCTTTAGCCTTCCTTCGATTACAACGTGATCTCTCCTCATCTTGTGCTGATGTGG
                      ____________________________________________________________
consensus ATGGTTCTTTAGCCTTCCTTCGATTACAACGTGATCTCTCCTCATCTTGTGCTGATGTGG
 
. : . : . : . : . : . :
JMFF016K19+ CAGTGGTGTCAGACCGCGGCTTTGCGGTGGGATTGCTGTTGCTGTTGGAGCCACTAACTT
JMFS154H10+ CAGTGGTGTCAGACCGCGGCTTTGCGGTGGGATTGCTGTTGCTGTTGGAGCCACTAACTT
JMSF016M18+ CAGTGGTGTCAGACCGCGGCTTTGCGGTGGGATTGCTGTTGCTGTTGGAGCCACTAACTT
JMSF025L19+ CAGTGGTGTCAGACCGCGGCTTTGCGGTGGGATTGCTGTTGCTGTTGGAGCCACTAACTT
JMFF044B11+ CAGTGGTGTCAGACCGCGGCTTTGCGGTGGGATTGCTGTTGCTGTTGGAGCCACTAACTT
JMFF047J14+ CAGTGGTGTCAGACCGCGGCTTTGCGGTGGGATTGCTGTTGCTGTTGGAGCCACTAACTT
                      ____________________________________________________________
consensus CAGTGGTGTCAGACCGCGGCTTTGCGGTGGGATTGCTGTTGCTGTTGGAGCCACTAACTT
 
. : . : . : . : . : . :
JMFF016K19+ TTGAGCTCGAAAGGCATATACCCATTTCCCCAAATATGGATATGGATAAAACCCAAAGTT
JMFS154H10+ TTGAGCTCGAAAGGCATATACCCATTTCCCCAAATATGGATATGGATAAAACCCAAAGTT
JMSF016M18+ TTGAGCTCGAAAGGCATATACCCATTTCCCCAAATATGGATATGGATAAAACCCAAAGTT
JMSF025L19+ TTGAGCTCGAAAGGCATATACCCATTTCCCCAAATATGGATATGGATAAAACCCAAAGTT
JMFF044B11+ TTGAGCTCGAAAGGCATATACCCATTTCCCCAAATATGGATATGGATAAAACCCAAAGTT
JMFF047J14+ TTGAGCTCGAAAGGCATATACCCATTTCCCCAAATATGGATATGGATAAAACCCAAAGTT
JMSF001P02+ CCAAGTATGGATATGGATAAAACCCAAAGTT
                      ____________________________________________________________
consensus TTGAGCTCGAAAGGCATATACCCATTTCCCCAAATATGGATATGGATAAAACCCAAAGTT
 
. : . : . : . : . : . :
JMFF016K19+ TTCTTCAGATTCTTTGACGGATCAGAAGGTTCACAAGCATAAGATGATGATTCAACAAAA
JMFS154H10+ TTCTTCAGATTCTTTGACGGATCAGAAGGTTCACAAGCATAAGATGATGATTCAACAAAA
JMSF016M18+ TTCTTCAGATTCTTTGACGGATCAGAAGGTTCACAAGCATAAGATGATGATTCAACAAAA
JMSF025L19+ TTCTTCAGATTCTTTGACGGATCAGAAGGTTCACAAGCATAAGATGATGATTCAACAAAA
JMFF044B11+ TTCTTCAGATTCTTTGACGGATCAGAAGGTTCACAAGCATAAGATGATGATTCAACAAAA
JMFF047J14+ TTCTTCAGATTCTTTGACGGATCAGAAGGTTCACAAGCATAAGATGATGATTCAACAAAA
JMSF001P02+ TTCTTCAGATTCTTTGACGGATCAGAAGGTTCACAAGCATAAGATGATGATTCAACAAAA
                      ____________________________________________________________
consensus TTCTTCAGATTCTTTGACGGATCAGAAGGTTCACAAGCATAAGATGATGATTCAACAAAA
 
. : . : . : . : . : . :
JMFF016K19+ TATGGGAAATGATCATTATAC
JMFS154H10+ TATGGGAAATGATCATTATACACAAAAATAAAAGGGCGAATGGAGAATCAACTCCGCGTC
JMSF016M18+ TATGGGAAATGATCATTATACACAAAAATAAAAGGGCGAATGGAGAATCAACTCCGCGTC
JMSF025L19+ TATGGGAAATGATCATTATACACAAAAATAAAAGGGCGAATGGAGAATCAACTCCGCGTC
JMFF044B11+ TATGGGAAATGATCATTATACACAAAAATAAAAGGGCGAATGGAGAATCAACTCCGCGTC
JMFF047J14+ TATGGGAAATGATCATTATACACAAAAATAAAAGGGCGAATGGAGAATCAACTCCGCGTC
JMSF001P02+ TATGGGAAATGATCATTATACACAAAAATAAAAGGGCGAATGGAGAATCAACTCCGCGTC
                      ____________________________________________________________
consensus TATGGGAAATGATCATTATACACAAAAATAAAAGGGCGAATGGAGAATCAACTCCGCGTC
 
. : . : . : . : . : . :
JMFS154H10+ CGTTTATACCAAAGTGAGAATTTAGGAGGAAGGTATGGTGGAGCAGCCAAGGAGGAAGAA
JMSF016M18+ CGTTTATACCAAAGTGAGAATTTAGGAGGAAGGTATGGTGGAGCAGCCAAGGAGGAAGAA
JMSF025L19+ CGTTTATACCAAAGTGAGAATTTAGGAGGAAGGTATGGTGGAGCAGCCAAGGAGGAAGAA
JMFF044B11+ CGTTTATACCAAAGTGAGAATTTAGGAGGAAGGTATGGTGGAGCAGCCAAGGAGGAAGAA
JMFF047J14+ CGTTTATACCAAAGTGAGAATTTAGGAGGAAGGTATGGTGGAGCAGCCAAGGAGGAAGAA
JMSF001P02+ CGTTTATACCAAAGTGAGAATTTAGGAGGAAGGTATGGTGGAGCAGCCAAGGAGGAAGAA
                      ____________________________________________________________
consensus CGTTTATACCAAAGTGAGAATTTAGGAGGAAGGTATGGTGGAGCAGCCAAGGAGGAAGAA
 
. : . : . : . : . : . :
JMFS154H10+ GAGAAGAAGTTGCTGACTT
JMSF016M18+ GAGAAGAAGTTGCTGACTTGCTGGTCAAAATAGACTTT
JMSF025L19+ GAGAAGAAGTTGCTGACTTGCTGGTCAAAATAGACTTT
JMFF044B11+ GAGAAGAAGTTGCTGACTTGCTGGTCAAAATAGACTTTAGAGGAGACAGCAGAAGCCCGT
JMFF047J14+ GAGAAGAAGTTGCTGACTTGCTGGTCAAAATAGACTTTAGAGGAGACAGCAGAAGCCCGT
JMSF001P02+ GAGAAGAAGTTGCTGACTTGCTGGTCAAAATAGACTTTAGAGGAGACAGCAGAAGCCCGT
                      ____________________________________________________________
consensus GAGAAGAAGTTGCTGACTTGCTGGTCAAAATAGACTTTAGAGGAGACAGCAGAAGCCCGT
 
. : . : . : . : . : . :
JMFF044B11+ TCCC
JMFF047J14+ TCCCGAAGGTGATCCCCTGCAGGGGTTT
JMSF001P02+ TCCCGAAGGTGATCCCCTGCAGGGGTTTGCCTGAAGAACCTCCAAATTTCTTTCTTTTCC
                      ____________________________________________________________
consensus TCCCGAAGGTGATCCCCTGCAGGGGTTTGCCTGAAGAACCTCCAAATTTCTTTCTTTTCC