Previous Contig 004362:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001O14Sequence213004362 (4)586013901 (4)
JMSF008H17Sequence411004362 (4)gb:AY085215_15702882e-06Arabidopsis thaliana clone 13887 mRNA, complete sequence.>gb:AY123988_1580069 Ar785013901 (4)gb:AP005867_18592891e-04Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P059
JMSF032P09Sequence645004362 (4)gb:AY085215_15702889e-30Arabidopsis thaliana clone 13887 mRNA, complete sequence.>gb:AY123988_1580069 Ar690013901 (4)
JMSF050M04Sequence656004362 (4)gb:AY085215_15702881e-30Arabidopsis thaliana clone 13887 mRNA, complete sequence.>gb:AY123988_1580069 Ar705013901 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF032P09+ CCAAGTTCTTCTGATGTAAGATCACGAGCCTCATCTTCATTGGCTGTTATGACT
JMSF050M04+ TTCCCAAGTTCTTCTGATGTAAGATCACGAGCNTCATCTTCATTGGCTGTTATGACT
                      ____________________________________________________________
consensus TTCCCAAGTTCTTCTGATGTAAGATCACGAGCCTCATCTTCATTGGCTGTTATGACT
 
. : . : . : . : . : . :
JMSF032P09+ CTTGTTTTCACAGCAGCTTTTGGATGAACATCAATGCTATCAAGCCATGCATCCTTGATA
JMSF050M04+ CTTGTTTTCACAGCAGCTTTTGGATGAACATCAATGCTATCAAGCCATGCATCCTTGATA
                      ____________________________________________________________
consensus CTTGTTTTCACAGCAGCTTTTGGATGAACATCAATGCTATCAAGCCATGCATCCTTGATA
 
. : . : . : . : . : . :
JMSF032P09+ TCATTTTCATTGACATACTCAACATAATTTCCATTGGCATCAAAATAACCTTCTTCCCTC
JMSF050M04+ TCATTTTCATTGACATACTCAACATAATTTCCATTGGCATCAAAATAACCTTCTTCCCTC
                      ____________________________________________________________
consensus TCATTTTCATTGACATACTCAACATAATTTCCATTGGCATCAAAATAACCTTCTTCCCTC
 
. : . : . : . : . : . :
JMSF032P09+ TCTTTGTTCAGATTGAAGGGTTCTATCTGAATCCCATCCTCAACAAATGTTTCATTATCC
JMSF050M04+ TCTTTGTTCAGATTGAAGGGTTCTATCTGAATCCCATCCTCAACAAATGTTTCATTATCC
                      ____________________________________________________________
consensus TCTTTGTTCAGATTGAAGGGTTCTATCTGAATCCCATCCTCAACAAATGTTTCATTATCC
 
. : . : . : . : . : . :
JMSF032P09+ TCATATGCCTCTTCGGCCAGTGCTATGTTGTGAACCATTCCTCTATTTCCTTCATCAAGG
JMSF008H17+ TCATATGCCTCTTCGGCCAGTGCTATGTTGTGAACCATTCCTCTATTTCCTTCATCAAGG
JMSF050M04+ TCATATGCCTCTTCGGCCAGTGCTATGTTGTGAACCATTCCTCTATTTCCTTCATCAAGG
                      ____________________________________________________________
consensus TCATATGCCTCTTCGGCCAGTGCTATGTTGTGAACCATTCCTCTATTTCCTTCATCAAGG
 
. : . : . : . : . : . :
JMSF032P09+ AGGTCAGCTGTGATTTGACTTCGGCGCATTGCCCGCTCTTTGGCTGCAAGACGAGGATTC
JMSF008H17+ AGGTCAGCTGTGATTTGACTTCGGCGCATTGCCCGCTCTTTGGCTGCAAGACGAGGATTC
JMSF050M04+ AGGTCAGCTGTGATTTGACTTCGGCGCATTGCCCGCTCTTTGGCTGCAAGACGAGGATTC
                      ____________________________________________________________
consensus AGGTCAGCTGTGATTTGACTTCGGCGCATTGCCCGCTCTTTGGCTGCAAGACGAGGATTC
 
. : . : . : . : . : . :
JMSF032P09+ TTCCATCCACTTGGTAATTCCTCACTTCCATCCACCACATAATCACCACGCTTTAACTTC
JMSF008H17+ TTCCATCCACTTGGTAATTCCTCACTTCCATCCACCACATAATCACCACGCTTTAACTTC
JMSF050M04+ TTCCATCCACTTGGTAATTCCTCACTTCCATCCACCACATAATCACCACGCTTTAACTTC
                      ____________________________________________________________
consensus TTCCATCCACTTGGTAATTCCTCACTTCCATCCACCACATAATCACCACGCTTTAACTTC
 
. : . : . : . : . : . :
JMSF032P09+ TTACCTTTTGGGAACCTTACCCTCTTTTCCGCGGAGGGTTTTTGGGAGTCGTCGTCGACG
JMSF008H17+ TTACCTTTTGGGAACCTTACCCTCTTTTCCGCGGAGGGTTTTTGGGAGTCGTCGTCGACG
JMSF050M04+ TTACCTTTTGGGAACCTTACCCTCTTTTCCGCGGAGGGTTTTTGGGAGTCGTCGTCGACG
JMSF001O14+ TCCGCGGAGGGTTTTTGGGAGTCGTCGTCGACG
                      ____________________________________________________________
consensus TTACCTTTTGGGAACCTTACCCTCTTTTCCGCGGAGGGTTTTTGGGAGTCGTCGTCGACG
 
. : . : . : . : . : . :
JMSF032P09+ GAATCCACGAAAGGACGCTTGCGAGATCGCTGTGGTCCTCCTTCCTCCATGGCCTATCGT
JMSF008H17+ GAATCCACGAAAGGACGCTTGCGAGATCGCTGTGGTCCTCCTTCCTCCATGGCCTATCGT
JMSF050M04+ GAATCCACGAAAGGACGCTTGCGAGATCGCTGTGGTCCTCCTTCCTCCATGGCCTATCGT
JMSF001O14+ GAATCCACGAAAGGACGCTTGCGAGATCGCTGTGGTCCTCCTTCCTCCATGGCCTATCGT
                      ____________________________________________________________
consensus GAATCCACGAAAGGACGCTTGCGAGATCGCTGTGGTCCTCCTTCCTCCATGGCCTATCGT
 
. : . : . : . : . : . :
JMSF032P09+ CGGCGTAGCTCCGAGCAGTTGGTTCGGCAATAAACCGTGATTCTATACAGCTAAGGCGAT
JMSF008H17+ CGGCGTAGCTCCGAGCAGTTGGTTCGGCAATAAACCGTGATTCTATACAGCTAAGGCGAT
JMSF050M04+ CGGCGTAGCTCCGAGCAGTTGGTTCGGCAATAAACCGTGATTCTATACAGCTAAGGCGAT
JMSF001O14+ CGGCGTAGCTCCGAGCAGTTGGTTCGGCAATAAACCGTGATTCTATACAGCTAAGGCGAT
                      ____________________________________________________________
consensus CGGCGTAGCTCCGAGCAGTTGGTTCGGCAATAAACCGTGATTCTATACAGCTAAGGCGAT
 
. : . : . : . : . : . :
JMSF032P09+ TGCCGGTCACTGTTTTTCCTTTCCAAAAATGCAATTTCAAATATCAATTC
JMSF008H17+ TGCCGGTCACTGTTTTTCCTTTCCAAAAATGCAATTTCAAATATCAATTC
JMSF050M04+ TGCCGGTCACTGTTTTTCCTTTCCAAAAATGCAATTTCAAATATCAATTCGGGCTCAAC
JMSF001O14+ TGCCGGTCACTGTTTTTCCTTTCCAAAAATGCAATTTCAAATATCAATTCGGGCTCAACC
                      ____________________________________________________________
consensus TGCCGGTCACTGTTTTTCCTTTCCAAAAATGCAATTTCAAATATCAATTCGGGCTCAACC