Previous Contig 004359:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001N18Sequence267004359 (3)gb:BC084646_25639473e-05Xenopus laevis hypothetical LOC495230, mRNA (cDNA clone MGC:98250 IMAGE:5440191)751013564 (3)gb:AP004658_18428060.001Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P004
JMSF018K08Sequence578004359 (3)gb:AY150521_15850863e-17Vitis vinifera putative heterogeneous nuclear ribonucleoprotein mRNA, partial cd771013564 (3)gb:AP004658_18428060.001Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P004
JMSF044M03Sequence763004359 (3)gb:AY113171_15782455e-26Arabidopsis thaliana AT4g00830/A_TM018A10_14 mRNA, complete cds.>gb:AF367357_179679013564 (3)gb:AP004658_18428060.001Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P004

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044M03+ CCCAAATCG
                      ____________________________________________________________
consensus CCCAAATCG
 
. : . : . : . : . : . :
JMSF044M03+ CTCAAAGAGTTCCCTCAAGTAATTTTCATCAGCTTCAGATGGAAGATTTCTAACAAAGGC
                      ____________________________________________________________
consensus CTCAAAGAGTTCCCTCAAGTAATTTTCATCAGCTTCAGATGGAAGATTTCTAACAAAGGC
 
. : . : . : . : . : . :
JMSF044M03+ TATTTTGATCTTAGCAAGTTCTTTTTGATCAATTTCTTGTTCCTCCTCAGCCCATTGAAT
                      ____________________________________________________________
consensus TATTTTGATCTTAGCAAGTTCTTTTTGATCAATTTCTTGTTCCTCCTCAGCCCATTGAAT
 
. : . : . : . : . : . :
JMSF044M03+ AGCTGGATGCAAATTACCAAGAAGGAATTCTGAACTGGTTCCCAACCGATATGCACGAGA
                      ____________________________________________________________
consensus AGCTGGATGCAAATTACCAAGAAGGAATTCTGAACTGGTTCCCAACCGATATGCACGAGA
 
. : . : . : . : . : . :
JMSF044M03+ TGCAGCAGCATGAGATGAGAATTTAACAAAAGCAAAGCCCCGATTCCGTTGCTTTTGACC
                      ____________________________________________________________
consensus TGCAGCAGCATGAGATGAGAATTTAACAAAAGCAAAGCCCCGATTCCGTTGCTTTTGACC
 
. : . : . : . : . : . :
JMSF044M03+ AGCTTGCAGATCTCCATGCATTACAAGATTAACAGATACAACACCTGGAAAAACCTGGTG
                      ____________________________________________________________
consensus AGCTTGCAGATCTCCATGCATTACAAGATTAACAGATACAACACCTGGAAAAACCTGGTG
 
. : . : . : . : . : . :
JMSF044M03+ TATAAGGTTTTCAAATTCCTCAGCACTCCAACCTTTGTTAAGATTCCCAAAAAATAATGT
                      ____________________________________________________________
consensus TATAAGGTTTTCAAATTCCTCAGCACTCCAACCTTTGTTAAGATTCCCAAAAAATAATGT
 
. : . : . : . : . : . :
JMSF044M03+ ATCCTGCTCTATTGAAGGGAGAACACCAATCTTCCGTCCATCTATAACATATCCAGACTT
JMSF018K08+ AACATATCCAGACTT
                      ____________________________________________________________
consensus ATCCTGCTCTATTGAAGGGAGAACACCAATCTTCCGTCCATCTATAACATATCCAGACTT
 
. : . : . : . : . : . :
JMSF044M03+ TTCCTTTACAGCTTTTTCTGCAGCCTCTTTTGTTGCAAAACGTACAAACCCAAAACCCTT
JMSF018K08+ TTCCTTTACAGCTTTTTCTGCAGCCTCTTTTGTTGCAAAACGTACAAACCCAAAACCCTT
                      ____________________________________________________________
consensus TTCCTTTACAGCTTTTTCTGCAGCCTCTTTTGTTGCAAAACGTACAAACCCAAAACCCTT
 
. : . : . : . : . : . :
JMSF044M03+ TAGGTTGCCACTCTGGTCCTGTATCAGCCTTATTTCAACAATTTTGCCACAAGTAGAGAA
JMSF018K08+ TAGGTTGCCACTCTGGTCCTGTATCAGCCTTATTTCAACAATTTTGCCACAAGTAGAGAA
JMSF001N18+ TTCAACAATTTTGCCACAAGTAGAGAA
                      ____________________________________________________________
consensus TAGGTTGCCACTCTGGTCCTGTATCAGCCTTATTTCAACAATTTTGCCACAAGTAGAGAA
 
. : . : . : . : . : . :
JMSF044M03+ TACCTCTCTGATCTTGTCTTCAGTAACAGTACGGGCCAAACCACCAATAAAAACTTCTGA
JMSF018K08+ TACCTCTCTGATCTTGTCTTCAGTAACAGTACGGGCCAAACCACCAATAAAAACTTCTGA
JMSF001N18+ TACCTCTCTGATCTTGTCTTCAGTAACAGTACGGGCCAAACCACCAATAAAAACTTCTGA
                      ____________________________________________________________
consensus TACCTCTCTGATCTTGTCTTCAGTAACAGTACGGGCCAAACCACCAATAAAAACTTCTGA
 
. : . : . : . : . : . :
JMSF044M03+ ACCTTTATTAAAAGGATTCTGGTGTTCGGCTTGAAGATGCTCAGTCGAATGGCTCATCAG
JMSF018K08+ ACCTTTATTAAAAGGATTCTGGTGTTCGGCTTGAAGATGCTCAGTCGAATGGCTCATCAG
JMSF001N18+ ACCTTTATTAAAAGGATTCTGGTGTTCGGCTTGAAGATGCTCAGTCGAATGGCTCATCAG
                      ____________________________________________________________
consensus ACCTTTATTAAAAGGATTCTGGTGTTCGGCTTGAAGATGCTCAGTCGAATGGCTCATCAG
 
. : . : . : . : . : . :
JMSF044M03+ TGCAGGTGATGAATTGGAGCTTCAGTTGCAGTTGGTCAGTGCGCGGTAATTGGAACTGGA
JMSF018K08+ TGCAGGTGATGAATTGGAGCTTCAGTTGCAGTTGGTCAGTGCGCGGTAATTGGAACTGGA
JMSF001N18+ TGCAGGTGATGAATTGGAGCTTCAGTTGCAGTTGGTCAGTGCGCGGTAATTGGAACTGGA
                      ____________________________________________________________
consensus TGCAGGTGATGAATTGGAGCTTCAGTTGCAGTTGGTCAGTGCGCGGTAATTGGAACTGGA
 
. : . : . : . : . : . :
JMSF044M03+ ACCCTAAAATTCCAGCGAATTGTCACTGCTC
JMSF018K08+ ACCCTAAAATTCCAGCGAATTGTCACTGCTC
JMSF001N18+ ACCCTAAAATTCCAGCGAATTGTCACTGCTCGAAGAACGGTGGCCGCAACTTTTCCCCTC
                      ____________________________________________________________
consensus ACCCTAAAATTCCAGCGAATTGTCACTGCTCGAAGAACGGTGGCCGCAACTTTTCCCCTC