Previous Contig 004357:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001N06Sequence354004357 (2)717012973 (2)pir|T06594|T065948e-43heat shock protein dnaJ - garden pea>gb:PSDNAJ_1702114 P.sativum mRNA for DnaJ-l
JMSF035F13Sequence669004357 (2)pir|T06594|T065943e-46heat shock protein dnaJ - garden pea>gb:PSDNAJ_1702114 P.sativum mRNA for DnaJ-l724012973 (2)pir|T06594|T065943e-42heat shock protein dnaJ - garden pea>gb:PSDNAJ_1702114 P.sativum mRNA for DnaJ-l

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF035F13+ CCCTTGGTAAC
                      ____________________________________________________________
consensus CCCTTGGTAAC
 
. : . : . : . : . : . :
JMSF035F13+ AGTGCTACGACGACCTGTTGGCCCAGTTCCAAAGCCAGCTGCATCCATTCCAAAATTGCC
                      ____________________________________________________________
consensus AGTGCTACGACGACCTGTTGGCCCAGTTCCAAAGCCAGCTGCATCCATTCCAAAATTGCC
 
. : . : . : . : . : . :
JMSF035F13+ AAGACCAGATCCAAAAAATGTCTCAAACAGATCAAAAGGGTTTGTCGTATAAGCACCAGC
                      ____________________________________________________________
consensus AAGACCAGATCCAAAAAATGTCTCAAACAGATCAAAAGGGTTTGTCGTATAAGCACCAGC
 
. : . : . : . : . : . :
JMSF035F13+ TTCAGCCCCTACGGTACTTCTAACCCCAGCTTCCCCGTATTGATCGTATAGAGCTCTCTT
                      ____________________________________________________________
consensus TTCAGCCCCTACGGTACTTCTAACCCCAGCTTCCCCGTATTGATCGTATAGAGCTCTCTT
 
. : . : . : . : . : . :
JMSF035F13+ TTTGTCATCTGATAATACCTCATAAGCATCTTTAATCGCCTTAAATTTTTCAGTTGCTTC
                      ____________________________________________________________
consensus TTTGTCATCTGATAATACCTCATAAGCATCTTTAATCGCCTTAAATTTTTCAGTTGCTTC
 
. : . : . : . : . : . :
JMSF035F13+ AGGTGCCTTGTTGACATCAGGGTGGTACTCACGAGCTAACTTCCGATAAGCGGCCTTAAT
                      ____________________________________________________________
consensus AGGTGCCTTGTTGACATCAGGGTGGTACTCACGAGCTAACTTCCGATAAGCGGCCTTAAT
 
. : . : . : . : . : . :
JMSF035F13+ CTCTTTACTGCTAGCAGATTTGGTGACCCCGAGAGTGGAGTAATAATCAGCTGCGGCGGC
JMSF001N06+ ACTGCTAGCAGATTTGGTGACCCCGAGAGTGGAGTAATAATCAGCTGCGGCGGC
                      ____________________________________________________________
consensus CTCTTTACTGCTAGCAGATTTGGTGACCCCGAGAGTGGAGTAATAATCAGCTGCGGCGGC
 
. : . : . : . : . : . :
JMSF035F13+ CACCACCAATCTCCCGAACCGCCTCGCCGATATCTTCCTGTCGTACTGAGACGAAGTGGA
JMSF001N06+ CACCACCAATCTCCCGAACCGCCTCGCCGATATCTTCCTGTCGTACTGAGACGAAGTGGA
                      ____________________________________________________________
consensus CACCACCAATCTCCCGAACCGCCTCGCCGATATCTTCCTGTCGTACTGAGACGAAGTGGA
 
. : . : . : . : . : . :
JMSF035F13+ AAAAGAAGAAGAAGAGAGGGAGATGGAAATCAGGAACCTCTTGTGGGACCAGAGATGGGT
JMSF001N06+ AAAAGAAGAAGAAGAGAGGGAGATGGAAATCAGGAACCTCTTGTGGGACCAGAGATGGGT
                      ____________________________________________________________
consensus AAAAGAAGAAGAAGAGAGGGAGATGGAAATCAGGAACCTCTTGTGGGACCAGAGATGGGT
 
. : . : . : . : . : . :
JMSF035F13+ CCCACCGGCAAAGAAGGTAGAAGACGAAGAAGGATGAGGCGGGAGAGAAGGGCGGAGTGA
JMSF001N06+ CCCACCGGCAAAGAAGGTAGAAGACGAAGAAGGATGAGGCGGGAGAGAAGGGCGGAGTGA
                      ____________________________________________________________
consensus CCCACCGGCAAAGAAGGTAGAAGACGAAGAAGGATGAGGCGGGAGAGAAGGGCGGAGTGA
 
. : . : . : . : . : . :
JMSF035F13+ CAGAGAGGCCGTGCAGGCCATTGTGGCGGTTGTCATTGGGCGTGAGAAACTACACGCGCC
JMSF001N06+ CAGAGAGGCCGTGCAGGCCATTGTGGCGGTTGTCATTGGGCGTGAGAAACTACACGCGCC
                      ____________________________________________________________
consensus CAGAGAGGCCGTGCAGGCCATTGTGGCGGTTGTCATTGGGCGTGAGAAACTACACGCGCC
 
. : . : . : . : . : . :
JMSF035F13+ ACCCAAGCGTTCGATGGTTTGCCTAGGAGAAAAAATGGAGGGAGCGGTTGATTTT
JMSF001N06+ ACCCAAGCGTTCGATGGTTTGCCTAGGAGAAAAAATGGAGGGAGCGGTTGATTTTGCCCC
                      ____________________________________________________________
consensus ACCCAAGCGTTCGATGGTTTGCCTAGGAGAAAAAATGGAGGGAGCGGTTGATTTTGCCCC