Previous Contig 004354:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005C21Sequence455004354 (16)gb:BT002179_16357826e-09Arabidopsis thaliana Unknown protein (At3g13460) mRNA, complete cds.731002852 (11)
JMFF007M18Sequence617004354 (16)gb:BT002179_16357823e-19Arabidopsis thaliana Unknown protein (At3g13460) mRNA, complete cds.780002852 (11)
JMFF023N04Sequence426004354 (16)pir|C96597|C965972e-06Rubisco subunit binding-protein beta subunit [imported] - Arabidopsis thaliana>g752002852 (11)
JMFF024F03Sequence496004354 (16)gb:BT002179_16357822e-13Arabidopsis thaliana Unknown protein (At3g13460) mRNA, complete cds.759002852 (11)
JMFF044H18Sequence645004354 (16)gb:BT002179_16357821e-22Arabidopsis thaliana Unknown protein (At3g13460) mRNA, complete cds.625002852 (11)
JMFF046K15Sequence634004354 (16)gb:BT002179_16357828e-22Arabidopsis thaliana Unknown protein (At3g13460) mRNA, complete cds.608002852 (11)
JMFS017F11Sequence618004354 (16)gb:BT002179_16357824e-21Arabidopsis thaliana Unknown protein (At3g13460) mRNA, complete cds.
JMFS043F02Sequence627004354 (16)gb:BT002179_16357822e-20Arabidopsis thaliana Unknown protein (At3g13460) mRNA, complete cds.
JMFS047C10Sequence620004354 (16)gb:BT002179_16357824e-19Arabidopsis thaliana Unknown protein (At3g13460) mRNA, complete cds.
JMFS054D06Sequence624004354 (16)gb:BT002179_16357829e-21Arabidopsis thaliana Unknown protein (At3g13460) mRNA, complete cds.
JMFS096B06Sequence617004354 (16)gb:BT002179_16357829e-21Arabidopsis thaliana Unknown protein (At3g13460) mRNA, complete cds.
JMFS097H06Sequence624004354 (16)gb:BT002179_16357829e-21Arabidopsis thaliana Unknown protein (At3g13460) mRNA, complete cds.
JMFS149G01Sequence293004354 (16)gb:BT002179_16357824e-08Arabidopsis thaliana Unknown protein (At3g13460) mRNA, complete cds.
JMFS155H01Sequence626004354 (16)gb:BT002179_16357822e-20Arabidopsis thaliana Unknown protein (At3g13460) mRNA, complete cds.
JMSF001M19Sequence243004354 (16)761002852 (11)
JMSF026D10Sequence670004354 (16)gb:BT002179_16357821e-20Arabidopsis thaliana Unknown protein (At3g13460) mRNA, complete cds.784002852 (11)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS097H06+ GGC
JMFS096B06+ GGCAGGGGC
JMSF026D10+ TGGCAGGGGC
                      ____________________________________________________________
consensus TGGCAGGGGC
 
. : . : . : . : . : . :
JMFF046K15+ GGACCACTCGTCAAAGGCTGGAAATATGGTGTAGGATACTGGTA
JMFF044H18+ AGCAGGAGTAGGGTATGGACCACTCGTCAAAGGCTGGAAATATGGTGTAGGATACTGGTA
JMFS054D06+ GGCTGGAAATATGGTGTAGGATACTGGTA
JMFS043F02+ GCAGGAGTAGGGTATGGACCACTCGTCAAAGGCTGGAAATATGGTGTAGGATACTGGTA
JMFS155H01+ GAGTAGGGTATGGACCACTCGTCAAAGGCTGGAAATATGGTGTAGGATACTGGTA
JMFS097H06+ AGCAGGAGTAGGGTATGGACCACTCGTCAAAGGCTGGAAATATGGTGTAGGATACTGGTA
JMFS047C10+ AATATGGTGTAGGATACTGGTA
JMFS096B06+ AGCAGGAGTAGGGTATGGACCACTCGTCAAAGGCTGGAAATATGGTGTAGGATACTGGTA
JMFF007M18+ TGGAAATATGGTGTAGGATACTGGTA
JMFS017F11+ GGCTGGAAATATGGTGTAGGATACTGGTA
JMSF026D10+ AGCAGGAGTAGGGTATGGACCACTCGTCAAAGGCTGGAAATATGGTGTAGGATACTGGTA
                      ____________________________________________________________
consensus AGCAGGAGTAGGGTATGGACCACTCGTCAAAGGCTGGAAATATGGTGTAGGATACTGGTA
 
. : . : . : . : . : . :
JMFF046K15+ GTGTTGAGCACCATATAACTGACCATCATGTCCCACAGTTGGCACTGGGGAAGTAGCAGG
JMFF044H18+ GTGTTGAGCACCATATAACTGACCATCATGTCCCACAGTTGGCACTGGGGAAGTAGCAGG
JMFS054D06+ GTGTTGAGCACCATATAACTGACCATCATGTCCCACAGTTGGCACTGGGGAAGTAGCAGG
JMFS043F02+ GTGTTGAGCACCATATAACTGACCATCATGTCCCACAGTTGGCACTGGGGAAGTAGCAGG
JMFS155H01+ GTGTTGAGCACCATATAACTGACCATCATGTCCCACAGTTGGCACTGGGGAAGTAGCAGG
JMFS097H06+ GTGTTGAGCACCATATAACTGACCATCATGTCCCACAGTTGGCACTGGGGAAGTAGCAGG
JMFS047C10+ GTGTTGAGCACCATATAACTGACCATCATGTCCCACAGTTGGCACTGGGGAAGTAGCAGG
JMFS096B06+ GTGTTGAGCACCATATAACTGACCATCATGTCCCACAGTTGGCACTGGGGAAGTAGCAGG
JMFF007M18+ GTGTTGAGCACCATATAACTGACCATCATGTCCCACAGTTGGCACTGGGGAAGTAGCAGG
JMFS017F11+ GTGTTGAGCACCATATAACTGACCATCATGTCCCACAGTTGGCACTGGGGAAGTAGCAGG
JMSF026D10+ GTGTTGAGCACCATATAACTGACCATCATGTCCCACAGTTGGCACTGGGGAAGTAGCAGG
                      ____________________________________________________________
consensus GTGTTGAGCACCATATAACTGACCATCATGTCCCACAGTTGGCACTGGGGAAGTAGCAGG
 
. : . : . : . : . : . :
JMFF046K15+ TGAATAAGGGCCATATGGAGTGTAACCATACCCATGCTGATACACAAGTGAACTATTGTC
JMFF044H18+ TGAATAAGGGCCATATGGAGTGTAACCATACCCATGCTGATACACAAGTGAACTATTGTC
JMFS054D06+ TGAATAAGGGCCATATGGAGTGTAACCATACCCATGCTGATACACAAGTGAACTATTGTC
JMFS043F02+ TGAATAAGGGCCATATGGAGTGTAACCATACCCATGCTGATACACAAGTGAACTATTGTC
JMFS155H01+ TGAATAAGGGCCATATGGAGTGTAACCATACCCATGCTGATACACAAGTGAACTATTGTC
JMFS097H06+ TGAATAAGGGCCATATGGAGTGTAACCATACCCATGCTGATACACAAGTGAACTATTGTC
JMFF024F03+ CATGCTGATACACAAGTGAACTATTGTC
JMFS047C10+ TGAATAAGGGCCATATGGAGTGTAACCATACCCATGCTGATACACAAGTGAACTATTGTC
JMFS096B06+ TGAATAAGGGCCATATGGAGTGTAACCATACCCATGCTGATACACAAGTGAACTATTGTC
JMFF007M18+ TGAATAAGGGCCATATGGAGTGTAACCATACCCATGCTGATACACAAGTGAACTATTGTC
JMFS017F11+ TGAATAAGGGCCATATGGAGTGTAACCATACCCATGCTGATACACAAGTGAACTATTGTC
JMSF026D10+ TGAATAAGGGCCATATGGAGTGTAACCATACCCATGCTGATACACAAGTGAACTATTGTC
                      ____________________________________________________________
consensus TGAATAAGGGCCATATGGAGTGTAACCATACCCATGCTGATACACAAGTGAACTATTGTC
 
. : . : . : . : . : . :
JMFF046K15+ CCCATACACTCCAGGCATCTCAACTCCTTCTGCATTCACATATCTAGGGTATCCCTCCCA
JMFF044H18+ CCCATACACTCCAGGCATCTCAACTCCTTCTGCATTCACATATCTAGGGTATCCCTCCCA
JMFS054D06+ CCCATACACTCCAGGCATCTCAACTCCTTCTGCATTCACATATCTAGGGTATCCCTCCCA
JMFS043F02+ CCCATACACTCCAGGCATCTCAACTCCTTCTGCATTCACATATCTAGGGTATCCCTCCCA
JMFS155H01+ CCCATACACTCCAGGCATCTCAACTCCTTCTGCATTCACATATCTAGGGTATCCCTCCCA
JMFS097H06+ CCCATACACTCCAGGCATCTCAACTCCTTCTGCATTCACATATCTAGGGTATCCCTCCCA
JMFF024F03+ CCCATACACTCCAGGCATCTCAACTCCTTCTGCATTCACATATCTAGGGTATCCCTCCCA
JMFS047C10+ CCCATACACTCCAGGCATCTCAACTCCTTCTGCATTCACATATCTAGGGTATCCCTCCCA
JMFS096B06+ CCCATACACTCCAGGCATCTCAACTCCTTCTGCATTCACATATCTAGGGTATCCCTCCCA
JMFS149G01+ AACTCCTTCTGCATTCACATATCTAGGGTATCCCTCCCA
JMFF007M18+ CCCATACACTCCAGGCATCTCAACTCCTTCTGCATTCACATATCTAGGGTATCCCTCCCA
JMFS017F11+ CCCATACACTCCAGGCATCTCAACTCCTTCTGCATTCACATATCTAGGGTATCCCTCCCA
JMFF005C21+ TCCTTCTGCATTCACATATCTAGGGTATCCCTCCCA
JMFF023N04+ CCTCCCA
JMSF026D10+ CCCATACACTCCAGGCATCTCAACTCCTTCTGCATTCACATATCTAGGGTATCCCTCCCA
                      ____________________________________________________________
consensus CCCATACACTCCAGGCATCTCAACTCCTTCTGCATTCACATATCTAGGGTATCCCTCCCA
 
. : . : . : . : . : . :
JMFF046K15+ CTCATTGCCTGTCCCATCATATCCTCCATAATAGTATGGATAACCATTAGGAAGATAGCA
JMFF044H18+ CTCATTGCCTGTCCCATCATATCCTCCATAATAGTATGGATAACCATTAGGAAGATAGCA
JMFS054D06+ CTCATTGCCTGTCCCATCATATCCTCCATAATAGTATGGATAACCATTAGGAAGATAGCA
JMFS043F02+ CTCATTGCCTGTCCCATCATATCCTCCATAATAGTATGGATAACCATTAGGAAGATAGCA
JMFS155H01+ CTCATTGCCTGTCCCATCATATCCTCCATAATAGTATGGATAACCATTAGGAAGATAGCA
JMFS097H06+ CTCATTGCCTGTCCCATCATATCCTCCATAATAGTATGGATAACCATTAGGAAGATAGCA
JMFF024F03+ CTCATTGCCTGTCCCATCATATCCTCCATAATAGTATGGATAACCATTAGGAAGATAGCA
JMFS047C10+ CTCATTGCCTGTCCCATCATATCCTCCATAATAGTATGGATAACCATTAGGAAGATAGCA
JMFS096B06+ CTCATTGCCTGTCCCATCATATCCTCCATAATAGTATGGATAACCATTAGGAAGATAGCA
JMFS149G01+ CTCATTGCCTGTCCCATCATATCCTCCATAATAGTATGGATAACCATTAGGAAGATAGCA
JMFF007M18+ CTCATTGCCTGTCCCATCATATCCTCCATAATAGTATGGATAACCATTAGGAAGATAGCA
JMFS017F11+ CTCATTGCCTGTCCCATCATATCCTCCATAATAGTATGGATAACCATTAGGAAGATAGCA
JMFF005C21+ CTCATTGCCTGTCCCATCATATCCTCCATAATAGTATGGATAACCATTAGGAAGATAGCA
JMFF023N04+ CTCATTGCCTGTCCCATCATATCCTCCATAATAGTATGGATAACCATTAGGAAGATAGCA
JMSF026D10+ CTCATTGCCTGTCCCATCATATCCTCCATAATAGTATGGATAACCATTAGGAAGATAGCA
                      ____________________________________________________________
consensus CTCATTGCCTGTCCCATCATATCCTCCATAATAGTATGGATAACCATTAGGAAGATAGCA
 
. : . : . : . : . : . :
JMFF046K15+ CAGAGTTGGATCCATGAAATCTGGTATCAAAGGAGAAAATGACCGATCAGCCGGCTGGAT
JMFF044H18+ CAGAGTTGGATCCATGAAATCTGGTATCAAAGGAGAAAATGACCGATCAGCCGGCTGGAT
JMFS054D06+ CAGAGTTGGATCCATGAAATCTGGTATCAAAGGAGAAAATGACCGATCAGCCGGCTGGAT
JMFS043F02+ CAGAGTTGGATCCATGAAATCTGGTATCAAAGGAGAAAATGACCGATCAGCCGGCTGGAT
JMFS155H01+ CAGAGTTGGATCCATGAAATCTGGTATCAAAGGAGAAAATGACCGATCAGCCGGCTGGAT
JMFS097H06+ CAGAGTTGGATCCATGAAATCTGGTATCAAAGGAGAAAATGACCGATCAGCCGGCTGGAT
JMFF024F03+ CAGAGTTGGATCCATGAAATCTGGTATCAAAGGAGAAAATGACCGATCAGCCGGCTGGAT
JMFS047C10+ CAGAGTTGGATCCATGAAATCTGGTATCAAAGGAGAAAATGACCGATCAGCCGGCTGGAT
JMFS096B06+ CAGAGTTGGATCCATGAAATCTGGTATCAAAGGAGAAAATGACCGATCAGCCGGCTGGAT
JMFS149G01+ CAGAGTTGGATCCATGAAATCTGGTATCAAAGGAGAAAATGACCGATCAGCCGGCTGGAT
JMFF007M18+ CAGAGTTGGATCCATGAAATCTGGTATCAAAGGAGAAAATGACCGATCAGCCGGCTGGAT
JMFS017F11+ CAGAGTTGGATCCATGAAATCTGGTATCAAAGGAGAAAATGACCGATCAGCCGGCTGGAT
JMFF005C21+ CAGAGTTGGATCCATGAAATCTGGTATCAAAGGAGAAAATGACCGATCAGCCGGCTGGAT
JMFF023N04+ CAGAGTTGGATCCATGAAATCTGGTATCAAAGGAGAAAATGACCGATCAGCCGGCTGGAT
JMSF026D10+ CAGAGTTGGATCCATGAAATCTGGTATCAAAGGAGAAAATGACCGATCAGCCGGCTGGAT
                      ____________________________________________________________
consensus CAGAGTTGGATCCATGAAATCTGGTATCAAAGGAGAAAATGACCGATCAGCCGGCTGGAT
 
. : . : . : . : . : . :
JMFF046K15+ CTGACCATTAGCAGCATGGGTTGAATCAACCGACACCTTCTTGGTTGGCTCAGGAATTTC
JMFF044H18+ CTGACCATTAGCAGCATGGGTTGAATCAACCGACACCTTCTTGGTTGGCTCAGGAATTTC
JMFS054D06+ CTGACCATTAGCAGCATGGGTTGAATCAACCGACACCTTCTTGGTTGGCTCAGGAATTTC
JMFS043F02+ CTGACCATTAGCAGCATGGGTTGAATCAACCGACACCTTCTTGGTTGGCTCAGGAATTTC
JMFS155H01+ CTGACCATTAGCAGCATGGGTTGAATCAACCGACACCTTCTTGGTTGGCTCAGGAATTTC
JMFS097H06+ CTGACCATTAGCAGCATGGGTTGAATCAACCGACACCTTCTTGGTTGGCTCAGGAATTTC
JMFF024F03+ CTGACCATTAGCAGCATGGGTTGAATCAACCGACACCTTCTTGGTTGGCTCAGGAATTTC
JMFS047C10+ CTGACCATTAGCAGCATGGGTTGAATCAACCGACACCTTCTTGGTTGGCTCAGGAATTTC
JMFS096B06+ CTGACCATTAGCAGCATGGGTTGAATCAACCGACACCTTCTTGGTTGGCTCAGGAATTTC
JMFS149G01+ CTGACCATTAGCAGCATGGGTTGAATCAACCGACACCTTCTTGGTTGGCTCAGGAATTTC
JMFF007M18+ CTGACCATTAGCAGCATGGGTTGAATCAACCGACACCTTCTTGGTTGGCTCAGGAATTTC
JMFS017F11+ CTGACCATTAGCAGCATGGGTTGAATCAACCGACACCTTCTTGGTTGGCTCAGGAATTTC
JMFF005C21+ CTGACCATTAGCAGCATGGGTTGAATCAACCGACACCTTCTTGGTTGGCTCAGGAATTTC
JMFF023N04+ CTGACCATTAGCAGCATGGGTTGAATCAACCGACACCTTCTTGGTTGGCTCAGGAATTTC
JMSF026D10+ CTGACCATTAGCAGCATGGGTTGAATCAACCGACACCTTCTTGGTTGGCTCAGGAATTTC
JMSF001M19+ TTC
                      ____________________________________________________________
consensus CTGACCATTAGCAGCATGGGTTGAATCAACCGACACCTTCTTGGTTGGCTCAGGAATTTC
 
. : . : . : . : . : . :
JMFF046K15+ CAATGCTTTGGTGTGAGAATCCAAAGACAACGATTGCA-AAGTTCTGAAGTTTGATCTGC
JMFF044H18+ CAATGCTTTGGTGTGAGAATCCAAAGACAACGATTGCA-AAGTTCTGAAGTTTGATCTGC
JMFS054D06+ CAATGCTTTGGTCTGAGAATCCAAAGACAACGATTGCAGAAGTTCTGAAGTTTGATCTGC
JMFS043F02+ CAATGCTTTGGTCTGAGAATCCAAAGACAACGATTGCAGAAGTTCTGAAGTTTGATCTGC
JMFS155H01+ CAATGCTTTGGTCTGAGAATCCAAAGACAACGATTGCAGAAGTTCTGAAGTTTGATCTGC
JMFS097H06+ CAATGCTTTGGTCTGAGAATCCAAAGACAACGATTGCAGAAGTTCTGAAGTTTGATCTGC
JMFF024F03+ CAATGCTTTGGTCTGAGAATCCAAAGACAACGATTGCAGAAGTTCTGAAGTTTGATCTGC
JMFS047C10+ CAATGCTTTGGTCTGAGAATCCAAAGACAACGATTGCAGAAGTTCTGAAGTTTGATCTGC
JMFS096B06+ CAATGCTTTGGTCTGAGAATCCAAAGACAACGATTGCAGAAGTTCTGAAGTTTGATCTGC
JMFS149G01+ CAATGCTTTGGTCTGAGAATCCAAAGACAACGATTGCAGAAGTTCTGAAGTTT
JMFF007M18+ CAATGCTTTGGTCTGAGAATCCAAAGACAACGATTGCAGAAGTTCTGAAGTTTGATCTGC
JMFS017F11+ CAATGCTTTGGTCTGAGAATCCAAAGACAACGATTGCAGAAGTTCTGAAGTTTGATCTGC
JMFF005C21+ CAATGCTTTGGTCTGAGAATCCAAAGACAACGATTGCAGAAGTTCTGAAGTTTGATCTGC
JMFF023N04+ CAATGCTTTGGTCTGAGAATCCAAAGACAACGATTGCAGAAGTTCTGAAGTTTGATATGC
JMSF026D10+ CAATGCTTTGGTCTGAGAATCCAAAGACAACGATTGCAGAAGTTCTGAAGTTTGATCTGC
JMSF001M19+ CAATGCTTTGGTCTGAGAATCCAAAGACAACGATTGCAGAAGTTCTGAAGTTTGATCTGC
                      ____________________________________________________________
consensus CAATGCTTTGGTCTGAGAATCCAAAGACAACGATTGCAGAAGTTCTGAAGTTTGATCTGC
 
. : . : . : . : . : . :
JMFF046K15+ GGTGGGAGCAACTGCAGCAGCCATGGCGCGATCGATAGATCCTCTGGGGAAACCCTAGCG
JMFF044H18+ GGTGGGAGCAACTGCAGCAGCCATGGCGCGATCGATAGATCCTCTGGGGAAACCCTAGCG
JMFS054D06+ GGTGGGAGCAACTGCAGCAGCCATGGCGCGATCGATAGATCCTCTGGGGAAACCCTAGCG
JMFS043F02+ GGTGGGAGCAACTGCAGCAGCCATGGCGCGATCGATAGATCCTCTGGGGAAACCCTAGCG
JMFS155H01+ GGTGGGAGCAACTGCAGCAGCCATGGCGCGATCGATAGATCCTCTGGGGAAACCCTAGCG
JMFS097H06+ GGTGGGAGCAACTGCAGCAGCCATGGCGCGATCGATAGATCCTCTGGGGAAACCCTAGCG
JMFF024F03+ GGTGGGAGCAACTGCAGCAGCCATGGCGCGATCGATAGATCCTCTGGGGAAACCCTAGCG
JMFS047C10+ GGTGGGAGCAACTGCAGCAGCCATGGCGCGATCGATAGATCCTCTGGGGAAACCCTAGCG
JMFS096B06+ GGTGGGAGCAACTGCAGCAGCCATGGCGCGATCGATAGATCCTCTGGGGAAACCCTAGCG
JMFF007M18+ GGTGGGAGCAACTGCAGCAGCCATGGCGCGATCGATAGATCCTCTGGGGAAACCCTAGCG
JMFS017F11+ GGTGGGAGCAACTGCAGCAGCCATGGCGCGATCGATAGATCCTCTGGGGAAACCCTAGCG
JMFF005C21+ GGTGGGAGCAACTGCAGCAACCATGGCGCGATCGATAGATCCTCTGGGGAAACCCTAGCG
JMFF023N04+ GGTGGGAGCAACTGCAGCAGCCATGGCGCGATCGATAGATCCTCTGGGGAAACCCTAGCG
JMSF026D10+ GGTGGGAGCAACTGCAGCAGCCATGGCGCGATCGATAGATCCTCTGGGGAAACCCTAGCG
JMSF001M19+ GGTGGGAGCAACTGCAGCAGCCATGGCGCGATCGATAGATCCTCTGGGGAAACCCTAGCG
                      ____________________________________________________________
consensus GGTGGGAGCAACTGCAGCAGCCATGGCGCGATCGATAGATCCTCTGGGGAAACCCTAGCG
 
. : . : . : . : . : . :
JMFF046K15+ AGGAGGAGGAGGAAGAGGAGCAGTGAGGTGTATCAGCAGCAGCCACGAAGTGCGGGCGCG
JMFF044H18+ AGGAGGAGGAGGAAGAGGAGCAGTGAGGTGTATCAGCAGCAGCCACGAAGTGCGGGCGCG
JMFS054D06+ AGGAGGAGGAGGAAGAGGAGCAGTGAGGT
JMFS043F02+ AGGAGGAGGAGGAAGAGGAGCAGTGAGGTGTATCAGCAGCAGCCACGAAGTGCGGGCGCG
JMFS155H01+ AGGAGGAGGAGGAAGAGGAGCAGTGAGGTGTATCAGCAGCAGCCACGAAGTGCGGGCGCG
JMFS097H06+ AGGAGGAGGAGGAAGAGGAGCAGTGAGGTGTATCAGCAGCAGCCACGAAGTGCGGGCGCG
JMFF024F03+ AGGAGGAGGAGGAAGAGGAGCAGTGAGGTGTATCAGCAGCAGCCACGAAGTGCGGGCGCG
JMFS047C10+ AGGAGGAGGAGGAAGAGGAGCAGTGAGGTGTATCAGCAGCAGCCACGAAGTGCGGGCGCG
JMFS096B06+ AGGAGGAGGAGGAAGAGGAGCAGTGAGGTGTATCAGCAGCAGCCACGAAGTGCGGGCGCG
JMFF007M18+ AGGAGGAGGAGAAAGAGGAGCAGTGAGGTGTATCAGCAGCAGCCACGAAGTGCGGGCGCG
JMFS017F11+ AGGAGGA
JMFF005C21+ AGGAGGAGGAGGAAGAGGAGCAGTGAGGTGTATCAGCAGCAGCCACGAAGTGCGGGCGCG
JMFF023N04+ AGGAGGAGGAGGAAGAGGAGCAGTGAGGTGTATCAGCAGCAGCCACGAAGTGCGGGCGCG
JMSF026D10+ AGGAGGAGGAGGAAGAGGAGCAGTGAGGTGTATCAGCAGCAGCCACGAAGTGCGGGCGCG
JMSF001M19+ AGGAGGAGGAGGAAGAGGAGCAGTGAGGTGTATCAGCAGCAGCCACGAAGTGCGGGCGCG
                      ____________________________________________________________
consensus AGGAGGAGGAGGAAGAGGAGCAGTGAGGTGTATCAGCAGCAGCCACGAAGTGCGGGCGCG
 
. : . : . : . : . : . :
JMFF046K15+ CAAAGGAGGAGAGAGAAACAAGGGGGGCGAGGGTTTGGGGGTTTTT
JMFF044H18+ CAAAGGAGGAGAGAGAAACAAGGGGGGCGAGGGTTTGGGGGTTTTT
JMFS043F02+ CAAAGGAGGAGAGAGAAACAAGGGGGGC
JMFS155H01+ CAAAGGAGGAGAGAGAAACAAGGGGGGCGAG
JMFS097H06+ CAAAGGAGGAGAGAGAAACAA
JMFF024F03+ CAAAGGAGGAGAGAGAAACAAGGGGGGCGAGGGTTTGGGGGTTTTTAG
JMFS047C10+ CAAAGGAGGAGAGAGAAACAAGGGGGGCGAGGGTTTGGGGGTTTTTAGAGAGAGAAAG
JMFS096B06+ CAAAGGAG
JMFF007M18+ CAAAGGAGGAGAGAG-AACAAGGGGGGCGAGGGTTTGGGGGTTTTTAGAG
JMFF005C21+ CAAAGGAGGAGAGAGAAACAAGGGGGGCGAGGGTTTGGGGGTTTTTAGAGAGAGAAAGC
JMFF023N04+ CATAGGAGGAGAGAGAAACAAGGGGGGCGAGGGTTTGGGGGTTTTTAGAGAGAGAAAGC
JMSF026D10+ CAAAGGAGGAGAGAGAAACAAGGGGGGCGAGGGTTTGGGGGTTTTTAGAGAGAGAAAGC
JMSF001M19+ CAAAGGAGGAGAGAGAAACAAGGGGGGCGAGGGTTTGGGGGTTTTTAGAGAGAGAAAGCC
                      ____________________________________________________________
consensus CAAAGGAGGAGAGAGAAACAAGGGGGGCGAGGGTTTGGGGGTTTTTAGAGAGAGAAAGCC