Previous Contig 004345:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF033N17Sequence530004345 (6)gb:AY059387_15645359e-36Olea europaea putative cullin protein mRNA, complete cds.718009787 (6)gb:AC084296_17334533e-93Oryza sativa chromosome 3 BAC OSJNBb0024J04 genomic sequence, complete sequence.
JMSF001L08Sequence348004345 (6)gb:AY059387_15645353e-05Olea europaea putative cullin protein mRNA, complete cds.767009787 (6)gb:AC084296_1733453e-103Oryza sativa chromosome 3 BAC OSJNBb0024J04 genomic sequence, complete sequence.
JMSF009P10Sequence291004345 (6)gb:AY059387_15645355e-10Olea europaea putative cullin protein mRNA, complete cds.709009787 (6)gb:AL451005_19280947e-76Human DNA sequence from clone RP11-92B10 on chromosome X Contains the 5' end of
JMSF021H11Sequence666004345 (6)gb:AY059387_15645355e-54Olea europaea putative cullin protein mRNA, complete cds.
JMSF025K20Sequence638004345 (6)gb:AY059387_15645358e-62Olea europaea putative cullin protein mRNA, complete cds.756009787 (6)gb:AC084296_1733453e-102Oryza sativa chromosome 3 BAC OSJNBb0024J04 genomic sequence, complete sequence.
JMSF034G24Sequence682004345 (6)gb:AY059387_15645352e-55Olea europaea putative cullin protein mRNA, complete cds.627009787 (6)gb:AY091113_15743376e-77Arabidopsis thaliana putative cullin (At5g46210) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF025K20+ TTCA
                      ____________________________________________________________
consensus TTCA
 
. : . : . : . : . : . :
JMSF025K20+ CATAGGTTCTGTCAAGATACAAAGCTATACCACGGATCGTCAATATCTGATCACAAAAGT
JMSF021H11+ CTGATCACAAAAGT
JMSF034G24+ GATCGTCAATATCTGATCACAAAAGT
                      ____________________________________________________________
consensus CATAGGTTCTGTCAAGATACAAAGCTATACCACGGATCGTCAATATCTGATCACAAAAGT
 
. : . : . : . : . : . :
JMSF025K20+ CCTGCCAGCATTTCTCAACAAGTGATAAGAAAACCACCAAATCTTCACTTTGGCCAACCA
JMSF021H11+ CCTGCCAGCATTTCTCAACAAGTGATAAGAAAACCACCAAATCTTCACTTTGGCCAACCA
JMSF034G24+ CCTGCCAGCATTTCTCAACAAGTGATAAGAAAACCACCAAATCTTCACTTTGGCCAACCA
                      ____________________________________________________________
consensus CCTGCCAGCATTTCTCAACAAGTGATAAGAAAACCACCAAATCTTCACTTTGGCCAACCA
 
. : . : . : . : . : . :
JMSF025K20+ AAGATTGCAATGCCACAGCTATGTGTGTTTCACACTCTTTTTCAATCCGTTGATAGAGAC
JMSF021H11+ AAGATTGCAATGCCACAGCTATGTGTGTTTCACACTCTTTTTCAATCCGTTGATAGAGAC
JMFF033N17+ CAATCCGTTGATAGAGAC
JMSF034G24+ AAGATTGCAATGCCACAGCTATGTGTGTTTCACACTCTTTTTCAATCCGTTGATAGAGAC
                      ____________________________________________________________
consensus AAGATTGCAATGCCACAGCTATGTGTGTTTCACACTCTTTTTCAATCCGTTGATAGAGAC
 
. : . : . : . : . : . :
JMSF025K20+ TTCCACCCATCTTGTGCAGACAAAGGTCATTAACAGCCTGGTAGAGTTTTTCTAGATCAC
JMSF021H11+ TTCCACCCATCTTGTGCAGACAAAGGTCATTAACAGCCTGGTAGAGTTTTTCTAGATCAC
JMFF033N17+ TTCCACCCATCTTGTGCAGACAAAGGTCATTAACAGCCTGGTAGAGTTTTTCTAGATCAC
JMSF034G24+ TTCCACCCATCTTGTGCAGACAAAGGTCATTAACAGCCTGGTAGAGTTTTTCTAGATCAC
                      ____________________________________________________________
consensus TTCCACCCATCTTGTGCAGACAAAGGTCATTAACAGCCTGGTAGAGTTTTTCTAGATCAC
 
. : . : . : . : . : . :
JMSF025K20+ ATGGATCAGGCTGTTTCAAGAATATTGCGTTAATTGCAGACTTAAGAGTTGCCCAGGTGT
JMSF021H11+ ATGGATCAGGCTGTTTCAAGAATATTGCGTTAATTGCAGACTTAAGAGTTGCCCAGGTGT
JMFF033N17+ ATGGATCAGGCTGTTTCAAGAATATTGCGTTAATTGCAGACTTAAGAGTTGCCCAGGTGT
JMSF034G24+ ATGGATCAGGCTGTTTCAAGAATATTGCGTTAATTGCAGACTTAAGAGTTGCCCAGGTGT
                      ____________________________________________________________
consensus ATGGATCAGGCTGTTTCAAGAATATTGCGTTAATTGCAGACTTAAGAGTTGCCCAGGTGT
 
. : . : . : . : . : . :
JMSF025K20+ TTTCTTCAAAATTTGTGGGCAGAGTTGGTTTTGCTTTGACGAGCTTAATGACTAGCTTCT
JMSF021H11+ TTTCTTCAAAATTTGTGGGCAGAGTTGGTTTTGCTTTGACGAGCTTAATGACTAGCTTCT
JMSF009P10+ GCTTAATGACTAGCTTCT
JMFF033N17+ TTTCTTCAAAATTTGTGGGCAGAGTTGGTTTTGCTTTGACGAGCTTAATGACTAGCTTCT
JMSF034G24+ TTTCTTCAAAATTTGTGGGCAGAGTTGGTTTTGCTTTGACGAGCTTAATGACTAGCTTCT
                      ____________________________________________________________
consensus TTTCTTCAAAATTTGTGGGCAGAGTTGGTTTTGCTTTGACGAGCTTAATGACTAGCTTCT
 
. : . : . : . : . : . :
JMSF025K20+ TGGCGGGCTGGGGAAGAGTGGCCTTCTTGCGAGACAAATTAGCAGTGGCGGCGCGTGTAG
JMSF021H11+ TGGCGGGCTGGGGAAGAGTGGCCTTCTTGCGAGACAAATTAGCAGTGGCGGCGCGTGTAG
JMSF009P10+ NGGCGGGCTGGGGAAGAGTGNCCTTCTTGCGAGACAAATTAGCAGTGGCGGCGCGTGTAG
JMFF033N17+ TGGCGGGCTGGGGAAGAGTGGCCTTCTTGCGAGACAAATTAGCAGTGGCGGCGCGTGTAG
JMSF034G24+ TGGCGGGCTGGGGAAGAGTGGCCTTCTTGCGAGACAAATTAGCAGTGGCGGCGCGTGTAG
JMSF001L08+ GAAGAGTGCCCTTCTTGCGAGACAAATTAGCAGTGGCGGCGCGTGTAG
                      ____________________________________________________________
consensus TGGCGGGCTGGGGAAGAGTGGCCTTCTTGCGAGACAAATTAGCAGTGGCGGCGCGTGTAG
 
. : . : . : . : . : . :
JMSF025K20+ CGGACGCGCCGGGGCTGTCCAGATCCTCCATGCTAGCGGAGGAGGGGTCCTCATCGACGT
JMSF021H11+ CGGACGCGCCGGGGCTGTCCAGATCCTCCATGCTAGCGGAGGAGGGGTCCTCATCGACGT
JMSF009P10+ CGGACGCGCCGGGGCTGTCCAGATCCTCCATGCTAGCGGAGGAGGGGTCCTCATCGACGT
JMFF033N17+ CGGACGCGCCGGGGCTGTCCAGATCCTCCATGCTAGCGGAGGAGGGGTCCTCATCGACGT
JMSF034G24+ CGGACGCGCCGGGGCTGTCCAGATCCTCCATGCTAGCGGAGGAGGGGTCCTCATCGACGT
JMSF001L08+ CGGACGCGCCGGGGCTGTCCAGATCCTCCATGCTAGCGGAGGAGGGGTCCTCATCGACGT
                      ____________________________________________________________
consensus CGGACGCGCCGGGGCTGTCCAGATCCTCCATGCTAGCGGAGGAGGGGTCCTCATCGACGT
 
. : . : . : . : . : . :
JMSF025K20+ CGGGATAGAAGTGGACGTGGTGCTGGCCGTTCTTGTTAGTGTCGAGAGAGCACGCGACGG
JMSF021H11+ CGGGATAGAAGTGGACGTGGTGGTGGCCGTTCTTGTTAGTGTCGAGAGAGCACGCGACGG
JMSF009P10+ CGGGATAGAAGTGGACGTGGTGCTGGCCGTTCTTGTTAGTGTCGAGAGAGCACGCGACGG
JMFF033N17+ CGGGATAGAAGTGGACGTGGTGCTGGCCGTTCTTGTTAGTGTCGAGAGAGCACGCGACGG
JMSF034G24+ CGGGATAGAAGTGGACGTGGTGCTGGCCGTTCTTGTTAGTGTCGAGAGAGCACGCGACGG
JMSF001L08+ CGGGATAGAAGTGGACGTGGTGCTGGCCGTTCTTGTTAGTGTCGAGAGAGCACGCGACGG
                      ____________________________________________________________
consensus CGGGATAGAAGTGGACGTGGTGCTGGCCGTTCTTGTTAGTGTCGAGAGAGCACGCGACGG
 
. : . : . : . : . : . :
JMSF025K20+ CCTGCGACTTGGCCTTCTTCATTGGCGGAGGGCGGTGGAGTGGTGGCGCGCCGTCGCCGG
JMSF021H11+ CCTGCGACTTGGCCTTCTTCATTGGCGGAGGGCGGTGGAGTGGTGGCGCGCCGTCGCCGG
JMSF009P10+ CCTGCGACTTGGCCTTCTTCATTGGCGGAGGGCGGTGGAGTGGTGGCGCGCCGTCGCCGG
JMFF033N17+ CCTGCGACTTGGCCTTCTTCATTGGCGGAGGGCGGTGGAGTGGTGGCGCGCCGTCGCCGG
JMSF034G24+ CCTGCGACTTGGCCTTCTTCATTGGCGGAGGGCGGTGGAGTGGTGGCGCGCCGTCGCCGG
JMSF001L08+ CCTGCGACTTGGCCTTCTTCATTGGCGGAGGGCGGTGGAGTGGTGGCGCGCCGTCGCCGG
                      ____________________________________________________________
consensus CCTGCGACTTGGCCTTCTTCATTGGCGGAGGGCGGTGGAGTGGTGGCGCGCCGTCGCCGG
 
. : . : . : . : . : . :
JMSF025K20+ CGGTGGCGGAGCAGGAGGAGTAGGGAGATGAGC
JMSF021H11+ CGGTGGCGGAGCAGGAGGAGTAGGGAGATGAGCGCTTGTTGGGGTTGGAGGTGGGTTGAG
JMSF009P10+ CGGTGGCGGAGCAGGAGGAGTAGGGAGATGAGC
JMFF033N17+ CGGTGGCGGAGCAGGAGGAGTAGGGAGATGAGCGCTTGTTGGGGTTGGAGGTGGGTTGAG
JMSF034G24+ CGGTGGCGGAGCAGGAGGAGTAGGGAGATGAGCGCTTGTTGGGGTTGGAGGTGGGTTGAG
JMSF001L08+ CGGTGGCGGAGCAGGAGGAGTAGGGAGATGAGCGCTTGTTGGGGTTGGAGGTGGGTTGAG
                      ____________________________________________________________
consensus CGGTGGCGGAGCAGGAGGAGTAGGGAGATGAGCGCTTGTTGGGGTTGGAGGTGGGTTGAG
 
. : . : . : . : . : . :
JMSF021H11+ ACATATAGAAGAAAAGAAGAAAGCGAAATCTCAAGAGCTCATTGTCGAGCC
JMFF033N17+ ACATATAGAAGAAAAGAAGAAAGCGAAATCTC
JMSF034G24+ ACATATAGAAGAAAAGAAGAAAGCGAAATCTCAAGAGCTCATTGTCGAGCC
JMSF001L08+ ACATATAGAAGAAAAGAAGAAAGCGAAATCTCAAGAGCTCATTGTCGAGCCAAACGCATC
                      ____________________________________________________________
consensus ACATATAGAAGAAAAGAAGAAAGCGAAATCTCAAGAGCTCATTGTCGAGCCAAACGCATC