Previous Contig 004344:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS067F09Sequence622004344 (4)gb:BT010457_16404031e-37Arabidopsis thaliana ribonuclease II-related protein (At5g02250) mRNA, complete
JMFS112H07Sequence627004344 (4)gb:BT010457_16404034e-40Arabidopsis thaliana ribonuclease II-related protein (At5g02250) mRNA, complete
JMSF001L06Sequence389004344 (4)696011161 (2)gb:BT010457_16404035e-32Arabidopsis thaliana ribonuclease II-related protein (At5g02250) mRNA, complete
JMSF037C08Sequence644004344 (4)gb:BT010457_16404032e-33Arabidopsis thaliana ribonuclease II-related protein (At5g02250) mRNA, complete 697011161 (2)gb:BT010457_16404031e-32Arabidopsis thaliana ribonuclease II-related protein (At5g02250) mRNA, complete

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS112H07+ TCATCTCAGCCAGTTCTTCCACTGTAACAGATNTGTTATTTTCAAGAA
JMFS067F09+ GTTATTTTCAAGAA
                      ____________________________________________________________
consensus TCATCTCAGCCAGTTCTTCCACTGTAACAGATNTGTTATTTTCAAGAA
 
. : . : . : . : . : . :
JMFS112H07+ GCTCATTCCAAGCGAATTCAAGAAGTGCTGGATCCAAGTTATTATGAGCTTTCTGGACAA
JMFS067F09+ GCTCATTCCAAGCGAATTCAAGAAGTGCTGGATCCAAGTTATTATGAGCTTTCTGGACAA
JMSF037C08+ GAATTCAAGAAGTGCTGGATCCAAGTTATTATGAGCTTTCTGGACAA
                      ____________________________________________________________
consensus GCTCATTCCAAGCGAATTCAAGAAGTGCTGGATCCAAGTTATTATGAGCTTTCTGGACAA
 
. : . : . : . : . : . :
JMFS112H07+ AGTTTGATATCTCGATGGGGTCAAAGTTCTCAATTCCAGGAACAATAAAAGTAACTTGCT
JMFS067F09+ AGTTTGATATCTCGATGGGGTCAAAGTTCTCAATTCCAGGAACAATAAAAGTAACTTGCT
JMSF037C08+ AGTTTGATATCTCGATGGGGTCAAAGTTCTCAATTCCAGGAACAATAAAAGTAACTTGCT
                      ____________________________________________________________
consensus AGTTTGATATCTCGATGGGGTCAAAGTTCTCAATTCCAGGAACAATAAAAGTAACTTGCT
 
. : . : . : . : . : . :
JMFS112H07+ GTGGTTTTATTGAGGTTGTTACACCATTCTGATCTGAGACGGTCCAATTCTTTTTCCCAT
JMFS067F09+ GTGGTTTTATTGAGGTTGTTACACCATTCTGATCTGAGACGGTCCAATTCTTTTTCCCAT
JMSF037C08+ GTGGTTTTATTGAGGTTGTTACACCATTCTGATCTGAGACGGTCCAATTCTTTTTCCCAT
                      ____________________________________________________________
consensus GTGGTTTTATTGAGGTTGTTACACCATTCTGATCTGAGACGGTCCAATTCTTTTTCCCAT
 
. : . : . : . : . : . :
JMFS112H07+ CAGGTCTAAGAGCAACTGCTAGCAATAGCCTTTCAGAGTCCTTCTTGAACTCTAGCAGCA
JMFS067F09+ CAGGTCTAAGAGCAACTGCTAGCAATAGCCTTTCAGAGTCCTTCTTGAACTCTAGCAGCA
JMSF037C08+ CAGGTCTAAGAGCAACTGCTAGCAATAGCCTTTCAGAGTCCTTCTTGAACTCTAGCAGCA
                      ____________________________________________________________
consensus CAGGTCTAAGAGCAACTGCTAGCAATAGCCTTTCAGAGTCCTTCTTGAACTCTAGCAGCA
 
. : . : . : . : . : . :
JMFS112H07+ ACCCCTTTCGCATTGCTTGTTTTCCTACTTTATCCTCAAGAAGCTCACTAGTGCTGGTTA
JMFS067F09+ ACCCCTTTCGCATTGCTTGTTTTCCTACTTTATCCTCAAGAAGCTCACTAGTGCTGGTTA
JMSF037C08+ ACCCCTTTCGCATTGCTTGTTTTCCTACTTTATCCTCAAGAAGCTCACTAGTGCTGGTTA
JMSF001L06+ ATCCTCAAGAAGCTCACTAGTGCTGGTTA
                      ____________________________________________________________
consensus ACCCCTTTCGCATTGCTTGTTTTCCTACTTTATCCTCAAGAAGCTCACTAGTGCTGGTTA
 
. : . : . : . : . : . :
JMFS112H07+ ATCCCAATTCGGTAGAAGCACGAATTCTCCCTCGTTTGCGCAAGGAATAGAGCTCTTCTA
JMFS067F09+ ATCCCAATTCGGTAGAAGCACGAATTCTCCCTCGTTTGCGCAAGGAATAGAGCTCTTCTA
JMSF037C08+ ATCCCAATTCGGTAGAAGCACGAATTCCCCCTCGTTTGCGCAAGGAATAGAGCTCTTCTA
JMSF001L06+ ATCCCAATTCGGTAGAAGCACGAATTCTCCCTCGTTTGCGCAAGGAATAGAGCTCTTCTA
                      ____________________________________________________________
consensus ATCCCAATTCGGTAGAAGCACGAATTCTCCCTCGTTTGCGCAAGGAATAGAGCTCTTCTA
 
. : . : . : . : . : . :
JMFS112H07+ TGACGGTCTCAACCAGGCTTTGCACAGAGTAGCTCCGAGCACCGTCATGGCTGAGAGGAT
JMFS067F09+ TGACGGTCTCAACCAGGCTTTGCACAGAGTAGCTCCGAGCACCGTCATGGCTGAGAGGAT
JMSF037C08+ TGACGGTCTCAACCAGGCTTTGCACAGAGTAGCTCCGAGCACCGTCATGGCTGAGAGGAT
JMSF001L06+ TGACGGTCTCAACCAGGCTTTGCACAGAGTAGCTCCGAGCACCGTCATGGCTGAGAGGAT
                      ____________________________________________________________
consensus TGACGGTCTCAACCAGGCTTTGCACAGAGTAGCTCCGAGCACCGTCATGGCTGAGAGGAT
 
. : . : . : . : . : . :
JMFS112H07+ AAGGCGTGCAACGGGGAAGCGAGAACCGAGAATGCAATCTTAAGTATCTGTGAAACCGCC
JMFS067F09+ AAGGCGTGCAACGGGGAAGCGAGAACCGAGAATGCAATCTTAAGTATCTGTGAAACCGCC
JMSF037C08+ AAGGCGTGCAACGGGGAAGCGAGAACCGAGAATGCAATCTTAAGTATCTGTGAAACCGCC
JMSF001L06+ AAGGCGTGCAACGGGGAAGCGAGAACCGAGAATGCAATCTTAAGTATCTGTGAAACCGCC
                      ____________________________________________________________
consensus AAGGCGTGCAACGGGGAAGCGAGAACCGAGAATGCAATCTTAAGTATCTGTGAAACCGCC
 
. : . : . : . : . : . :
JMFS112H07+ GCGTTCTGAGTTGGCGCTGGGGACAACAGCTCCAGAACGTCGGCGCCAGCGGCGGAGGCG
JMFS067F09+ GCGTTCTGAGTTGGCGCTGGGGACAACAGCTCCAGAACGTCGGCGCCAGCGGCGGAGGCG
JMSF037C08+ GCGTTCTGAGTTGGCGCTGGGGACAACAGCTCCAGAACGTCGGCGCCAGCGGCGGAGGCG
JMSF001L06+ GCGTTCTGAGTTGGCGCTGGGGACAACAGCTCCAGAACGTCGGCGCCAGCGGCGGAGGCG
                      ____________________________________________________________
consensus GCGTTCTGAGTTGGCGCTGGGGACAACAGCTCCAGAACGTCGGCGCCAGCGGCGGAGGCG
 
. : . : . : . : . : . :
JMFS112H07+ ACGCTGCGGAGCGGATAAATATGCAGCTATTCATGGCGC
JMFS067F09+ ACGCTGCGGAGCGGATAAATATGCAGCTATTCATGGCGCGGGCTGCCATGTTCGGCGGTT
JMSF037C08+ ACGCTGCGGAGCGGATAAATATGCAGCTATTCATGGCGCGGGCTGCCATGTTCGGCGGTT
JMSF001L06+ ACGCTGCGGAGCGGATAAATATGCAGCTATTCATGGCGCGGGCTGCCATGTTCGGCGGTT
                      ____________________________________________________________
consensus ACGCTGCGGAGCGGATAAATATGCAGCTATTCATGGCGCGGGCTGCCATGTTCGGCGGTT
 
. : . : . : . : . : . :
JMFS067F09+ ACAACCTA
JMSF037C08+ ACAACCTATAACTACCTGGTTCAAGAAATTGTTTGGGGTTTGGATTGAGAGAGCC
JMSF001L06+ ACAACCTATAACTACCTGGTTCAAGAAATTGTTTGGGGTTTGGATTGAGAGAGCCAGTCC
                      ____________________________________________________________
consensus ACAACCTATAACTACCTGGTTCAAGAAATTGTTTGGGGTTTGGATTGAGAGAGCCAGTCC