Previous Contig 004342:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001L01Sequence451004342 (2)gb:AY087643_15726727e-10Arabidopsis thaliana clone 37302 mRNA, complete sequence.697013368 (3)gb:AY087643_15726721e-73Arabidopsis thaliana clone 37302 mRNA, complete sequence.
JMSF041L16Sequence660004342 (2)gb:AY087643_15726722e-43Arabidopsis thaliana clone 37302 mRNA, complete sequence.705013368 (3)gb:AY087643_15726724e-55Arabidopsis thaliana clone 37302 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041L16+ TANCCAGC
                      ____________________________________________________________
consensus TANCCAGC
 
. : . : . : . : . : . :
JMSF041L16+ CCCCAANTAGAATGCCAAAAATCTTCACCCCTGAAGAAGCTGGAATGTCTTTAACAGCTA
                      ____________________________________________________________
consensus CCCCAANTAGAATGCCAAAAATCTTCACCCCTGAAGAAGCTGGAATGTCTTTAACAGCTA
 
. : . : . : . : . : . :
JMSF041L16+ GAGGCAAGACCACCAAAGAAGGCACATAAAACAGTGGAAGCCATCTTTGAATAAATAAAA
                      ____________________________________________________________
consensus GAGGCAAGACCACCAAAGAAGGCACATAAAACAGTGGAAGCCATCTTTGAATAAATAAAA
 
. : . : . : . : . : . :
JMSF041L16+ GTGCAGGCTCAAAGAAGTTCACCAAGGCAGTTGCTGCGGCAGGGAGAATGGTATCAAGAA
                      ____________________________________________________________
consensus GTGCAGGCTCAAAGAAGTTCACCAAGGCAGTTGCTGCGGCAGGGAGAATGGTATCAAGAA
 
. : . : . : . : . : . :
JMSF041L16+ CTATTAAAACGGTGAAAGTGCAAAACATCCCAAATAGAGCACTTGGGAACTTAATGGCTG
JMSF001L01+ CCAAATAGAGCACTTGGGAACTTAATGGCTG
                      ____________________________________________________________
consensus CTATTAAAACGGTGAAAGTGCAAAACATCCCAAATAGAGCACTTGGGAACTTAATGGCTG
 
. : . : . : . : . : . :
JMSF041L16+ CAGCCACAAATGCCTGCTTCAGGTACTTATCCATTGCCAGTATAAGCCCAAGTGAAACTA
JMSF001L01+ CAGCCACAAATGCCTGCTTCAGGTACTTATCCATTGCCAGTATAAGCCCAAGTGAAACTA
                      ____________________________________________________________
consensus CAGCCACAAATGCCTGCTTCAGGTACTTATCCATTGCCAGTATAAGCCCAAGTGAAACTA
 
. : . : . : . : . : . :
JMSF041L16+ GCAAATGGAAAACGCCAATCACCTTGCTTGATAGGCTTGTGGAAGTGCTAGCACTACCGT
JMSF001L01+ GCAAATGGAAAACGCCAATCACCTTGCTTGATAGGCTTGTGGAAGTGCTAGCACTACCGT
                      ____________________________________________________________
consensus GCAAATGGAAAACGCCAATCACCTTGCTTGATAGGCTTGTGGAAGTGCTAGCACTACCGT
 
. : . : . : . : . : . :
JMSF041L16+ CTGATCCCACTGAATGGGCAAGGAATTTGGGAGTGGAGTGAGATTTGTGAGTACCCAATT
JMSF001L01+ CTGATCCCACTGAATGGGCAAGGAATTTGGGAGTGGAGTGAGATTTGTGAGTACCCAATT
                      ____________________________________________________________
consensus CTGATCCCACTGAATGGGCAAGGAATTTGGGAGTGGAGTGAGATTTGTGAGTACCCAATT
 
. : . : . : . : . : . :
JMSF041L16+ GCGAGAACTTGGGGTGTGGCCCAAGAAGTTTGATTTTTGCAGGGTTGGTGATTTGTAGGC
JMSF001L01+ GCGAGAACTTGGGGTGTGGCCCAAGAAGTTTGATTTTTGCAGGGTTGGTGATTTGTAGGC
                      ____________________________________________________________
consensus GCGAGAACTTGGGGTGTGGCCCAAGAAGTTTGATTTTTGCAGGGTTGGTGATTTGTAGGC
 
. : . : . : . : . : . :
JMSF041L16+ CGCCATTGGAGGCAAGCATGGGAATTTTTCTGGAATTCCGTACAGAGATGAAAGGGGTGA
JMSF001L01+ CGCCATTGGAGGCAAGCATGGGAATTTTTCTGGAATTCCGTACAGAGATGAAAGGGGTGA
                      ____________________________________________________________
consensus CGCCATTGGAGGCAAGCATGGGAATTTTTCTGGAATTCCGTACAGAGATGAAAGGGGTGA
 
. : . : . : . : . : . :
JMSF041L16+ TTCTTGATTGGTGATTGGGAAAGGAAAAAGACGATGATATGATTTGTGGAGCAGCAGAAG
JMSF001L01+ TTCTTGATTGGTGATTGGGAAAGGAAAAAGACGATGATATGATTTGTGGAGCAGCAGAAG
                      ____________________________________________________________
consensus TTCTTGATTGGTGATTGGGAAAGGAAAAAGACGATGATATGATTTGTGGAGCAGCAGAAG
 
. : . : . : . : . : . :
JMSF041L16+ GTGTTGCCGCCATGGGAATGGGCGATAGGGGGGGAGTGGAGGTGGAGAAGC
JMSF001L01+ GTGTTGCCGCCATGGGAATGGGCGATAGGGGGGGAGTGGAGGTGGAGAAGCGGATGCATC
                      ____________________________________________________________
consensus GTGTTGCCGCCATGGGAATGGGCGATAGGGGGGGAGTGGAGGTGGAGAAGCGGATGCATC