Previous Contig 004341:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF042A21Sequence656004341 (17)gb:AY283519_15947384e-49Brassica napus CLV1-like receptor kinase (CLAVATA1) gene, partial cds.613011160 (3)gb:AY283519_15947388e-77Brassica napus CLV1-like receptor kinase (CLAVATA1) gene, partial cds.
JMFS026C04Sequence621004341 (17)gb:AY283519_15947386e-25Brassica napus CLV1-like receptor kinase (CLAVATA1) gene, partial cds.
JMFS040D05Sequence611004341 (17)gb:AY283519_15947381e-42Brassica napus CLV1-like receptor kinase (CLAVATA1) gene, partial cds.
JMFS048G09Sequence592004341 (17)gb:AY283519_15947385e-46Brassica napus CLV1-like receptor kinase (CLAVATA1) gene, partial cds.
JMFS056F02Sequence627004341 (17)gb:AY283519_15947383e-48Brassica napus CLV1-like receptor kinase (CLAVATA1) gene, partial cds.
JMFS060C08Sequence612004341 (17)gb:AY283519_15947384e-29Brassica napus CLV1-like receptor kinase (CLAVATA1) gene, partial cds.
JMFS064D12Sequence632004341 (17)gb:AB162660_15286323e-71Ipomoea batatas CLAVATA-1 gene for protein kinase, exon 1, partial cds, Rtsp-1 t
JMFS068B01Sequence575004341 (17)gb:AY283519_15947384e-39Brassica napus CLV1-like receptor kinase (CLAVATA1) gene, partial cds.
JMFS069G08Sequence624004341 (17)gb:AY283519_15947383e-48Brassica napus CLV1-like receptor kinase (CLAVATA1) gene, partial cds.
JMFS072E02Sequence642004341 (17)gb:AY283519_15947384e-49Brassica napus CLV1-like receptor kinase (CLAVATA1) gene, partial cds.
JMFS077A07Sequence627004341 (17)gb:AB162660_15286328e-70Ipomoea batatas CLAVATA-1 gene for protein kinase, exon 1, partial cds, Rtsp-1 t
JMFS089B09Sequence627004341 (17)gb:AY283519_15947386e-49Brassica napus CLV1-like receptor kinase (CLAVATA1) gene, partial cds.
JMFS102F06Sequence613004341 (17)gb:AY283519_15947381e-42Brassica napus CLV1-like receptor kinase (CLAVATA1) gene, partial cds.
JMFS103E05Sequence551004341 (17)gb:AB092809_15251113e-56Lotus corniculatus var. japonicus HAR1 gene for LRR receptor-like kinase, hypoth
JMFS136F12Sequence621004341 (17)gb:AY283519_15947384e-29Brassica napus CLV1-like receptor kinase (CLAVATA1) gene, partial cds.
JMFS142A12Sequence626004341 (17)gb:AY283519_15947381e-46Brassica napus CLV1-like receptor kinase (CLAVATA1) gene, partial cds.
JMSF001K24Sequence297004341 (17)gb:AF049870_17641051e-04Arabidopsis thaliana beta tubulin 1, thaumatin-like protein (TL1), small hydroph764011160 (3)gb:AY283519_15947381e-76Brassica napus CLV1-like receptor kinase (CLAVATA1) gene, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS103E05+ GAAGTTGTTACCCCAAACCTGTAACGTTTCTAGGTTTGGAAGGTCGCCGATTAACGCC
                      ____________________________________________________________
consensus GAAGTTGTTACCCCAAACCTGTAACGTTTCTAGGTTTGGAAGGTCGCCGATTAACGCC
 
. : . : . : . : . : . :
JMFS103E05+ GGGATTGCACCGTGGAATTTGTTATTGAACAGATTTAAGAGCGTCAGAAATTTCAACTGA
JMFS077A07+ TGGAATTCGTTATTGAACAGGTTTAAGAGCGTCATATTTTTCAACTGA
                      ____________________________________________________________
consensus GGGATTGCACCGTGGAATTTGTTATTGAACAGGTTTAAGAGCGTCATATTTTTCAACTGA
 
. : . : . : . : . : . :
JMFS103E05+ GAGAAACTTTCAGGAATTTCTCCGGTCATATTGTTATACGAAATATCCAGAGACTTTAAA
JMFS077A07+ GCGAAACTTTCAGGAATTTCTCCGGTCATATTGTTATACGAAATATCCAGAGACATTAAA
JMFS064D12+ GAAATATCCAGAGACATTAAA
                      ____________________________________________________________
consensus GCGAAACTTTCAGGAATTTCTCCGGTCATATTGTTATACGAAATATCCAGAGACATTAAA
 
. : . : . : . : . : . :
JMFS103E05+ CTCTCCATATTCCCCAGCTCCGTCGGAATATGACCGGTGAGACTGTTCATTTGCAGGTAT
JMFS077A07+ CTCTCCATATTCCCCAGCTCCGGCGGAATATGACCGGTGAGACTGTTCATTTGCAGGAAT
JMFS064D12+ CTCTCCATATTCCCCAGCTCCGGCGGAATATGACCGGTGAGACTGTTCATTTGCAGGAAT
                      ____________________________________________________________
consensus CTCTCCATATTCCCCAGCTCCGGCGGAATATGACCGGTGAGACTGTTCATTTGCAGGAAT
 
. : . : . : . : . : . :
JMFS103E05+ AGATTATGCAGCCGTTTCAAATTCCCGAGGCTCGGCGGAATGGTGCCGGTGAGGTTACAG
JMFS077A07+ AGAGTATGCAGCCGTTTCAAATTCGCGAGGCTCGGCGGAATGGTGCCGGTGAGGTTACAG
JMFS064D12+ AGAGTATGCAGCCGTTTCAAATTCGCGAGGCTCGGCGGAATGGTGCCGGTGAGGTTACAG
                      ____________________________________________________________
consensus AGAGTATGCAGCCGTTTCAAATTCGCGAGGCTCGGCGGAATGGTGCCGGTGAGGTTACAG
 
. : . : . : . : . : . :
JMFS103E05+ CCGCCGAGATCGAGAAGGCGGAGAGTGGCGAACGAGCCGAACTCCGGCGGAACGCCGCCG
JMFS077A07+ CCGCCGAGATCGAGAAGGCGGAGAGTGGCGAACGAGCCGAACTCCGGCGGAACGCCGCCG
JMFS064D12+ CCGCCGAGATCGAGAAGGCGGAGAGTGGCGAACGAGCCGAACTCCGGCGGAACGCCGCCG
                      ____________________________________________________________
consensus CCGCCGAGATCGAGAAGGCGGAGAGTGGCGAACGAGCCGAACTCCGGCGGAACGCCGCCG
 
. : . : . : . : . : . :
JMFS103E05+ TGATATGTGTTGAAATAGCCTAGCTTTAGTTCCTCAAGGTTGGGGAGGTTAGACAGGCTT
JMFS077A07+ TGATATGTGTTGAAATAGCCTAGCTTTAGTTCCTCAAGGTTGGGGAGGTTAGACAGGCTT
JMFS064D12+ TGATATGTGTTGAAATAGCCTAGCTTTAGTTCCTCAAGGTTGGGGAGGTTAGACAGGCTT
                      ____________________________________________________________
consensus TGATATGTGTTGAAATAGCCTAGCTTTAGTTCCTCAAGGTTGGGGAGGTTAGACAGGCTT
 
. : . : . : . : . : . :
JMFS103E05+ GGAGGTATAACACCGGTGAGTGAGTTTCCCTGTAAGTGCAAAATCTGCAAACTAGTGATC
JMFS077A07+ GGAGGTATAACACCGGTGAGTGAGTTTCCCTGTAAGTGCAAAATCTGCAAACTAGTGATC
JMFS064D12+ GGAGGTATAACACCGGTGAGTGAGTTTCCCTGTAAGTGCAAAATCTGCAAACTAGTGATC
JMFS072E02+ GAGTGAGTTTCCCTGTAAGTGCAAAATCTGCAAACTAGTGATC
JMFS089B09+ TCCCTGTAAGTGCAAAATCTGCAAACTAGTGATC
JMFS056F02+ TGTAAGTGCAAAATCTGCAAACTAGTGATC
JMFS069G08+ CTGTAAGTGCAAAATCTGCAAACTAGTGATC
JMFF042A21+ TGAGTGAGTTTCCCTGTAAGTGCAAAATCTGCAAACTAGTGATC
JMFS142A12+ GTGATC
                      ____________________________________________________________
consensus GGAGGTATAACACCGGTGAGTGAGTTTCCCTGTAAGTGCAAAATCTGCAAACTAGTGATC
 
. : . : . : . : . : . :
JMFS103E05+ TCAGAGTACGCCGCCGGGATTTCTCCGGCGAAGTAATTCCCACCGAGAATAAGGTTCCTC
JMFS077A07+ TCAGAGTACGCCGCCGGGATTTCTCCGGCGAAGTAATTCCCGCCGAGAATAAGAGTCCTC
JMFS064D12+ TCAGAGTACGCCGCCGGGATTTCTCCGGCGAAGTAATTCCCGCCGAGAATAAGAGTCCTC
JMFS072E02+ TCAGAGTACGCCGCCGGGATTTCTCCGGCGAAGTAATTCCCGCCGAGAATAAGAGTCCTC
JMFS089B09+ TCAGAGTACGCCGCCGGGATTTCTCCGGCGAAGTAATTCCCGCCGAGAATAAGAGTCCTC
JMFS056F02+ TCAGAGTACGCCGCCGGGATTTCTCCGGCGAAGTAATTCCCGCCGAGAATAAGAGTCCTC
JMFS069G08+ TCAGAGTACGCCGCCGGGATTTCTCCGGCGAAGTAATTCCCGCCGAGAATAAGAGTCCTC
JMFS048G09+ CAGAGTACGCCGCCGGGATTTCTCCGGCGAAGTAATTCCCGCCGAGAATAAGAGTCCTC
JMFF042A21+ TCAGAGTACGCCGCCGGGATTTCTCCGGCGAAGTAATTCCCGCCGAGAATAAGAGTCCTC
JMFS142A12+ TCAGAGTACGCCGCCGGGATTTCTCCGGCGAAGTAATTCCCGCCGAGAATAAGAGTCCTC
JMFS102F06+ GGCGAAGTAATTCCCGCCGAGAATAAGAGTCCTC
JMFS068B01+ C
JMFS040D05+ CGAAGTAATTCCCGCCGAGAATAAGAGTCCTC
                      ____________________________________________________________
consensus TCAGAGTACGCCGCCGGGATTTCTCCGGCGAAGTAATTCCCGCCGAGAATAAGAGTCCTC
 
. : . : . : . : . : . :
JMFS103E05+ AGTTTCTTCATCT
JMFS077A07+ AGTTTCTTCATCTTCACGACCTCCACCGGGAGGTTACCGGTGAAGTTATTGTTGTAAACG
JMFS064D12+ AGTTTCTTCATCTTCACGACCTCCACCGGGAGGTTACCGGTGAAGTTATTGTTGTAAACG
JMFS072E02+ AGTTTCTTCATCTTCACGACCTCCACCGGGAGGTTACCGGTGAAGTTATTGTTGTAAACG
JMFS089B09+ AGTTTCTTCATCTTCACGACCTCCACCGGGAGGTTACCGGTGAAGTTATTGTTGTAAACG
JMFS056F02+ AGTTTCTTCATCTTCACGACCTCCACCGGGAGGTTACCGGTGAAGTTATTGTTGTAAACG
JMFS069G08+ AGTTTCTTCATCTTCACGACCTCCACCGGGAGGTTACCGGTGAAGTTATTGTTGTAAACG
JMFS048G09+ AGTTTCTTCATCTTCACGACCTCCACCGGGAGGTTACCGGTGAAGTTATTGTTGTAAACG
JMFF042A21+ AGTTTCTTCATCTTCACGACCTCCACCGGGAGGTTACCGGTGAAGTTATTGTTGTAAACG
JMFS142A12+ AGTTTCTTCATCTTCACGACCTCCACCGGGAGGTTACCGGTGAAGTTATTGTTGTAAACG
JMFS102F06+ AGTTTCTTCATCTTCACGACCTCCACCGGGAGGTTACCGGTGAAGTTATTGTTGTAAACG
JMFS068B01+ AGTTTCTTCATCTTCACGACCTCCACCGGGAGGTTACCGGTGAAGTTATTGTTGTAAACG
JMFS040D05+ AGTTTCTTCATCTTCACGACCTCCACCGGGAGGTTACCGGTGAAGTTATTGTTGTAAACG
                      ____________________________________________________________
consensus AGTTTCTTCATCTTCACGACCTCCACCGGGAGGTTACCGGTGAAGTTATTGTTGTAAACG
 
. : . : . : . : . : . :
JMFS077A07+ TTAAACACCTCAAGCTCCGTCATCCCACCCAAGATCTCCCCGGGGAAGTCACCGGAAAAA
JMFS064D12+ TTAAACACCTCAAGCTCCGTCATCCCACCCAAGATCTCCCCGGGGAAGTCACCGGAAAAA
JMFS072E02+ TTAAACACCTCAAGCTCCGTCATCCCACCCAAGATCTCCCCGGGGAAGTCACCGGAAAAA
JMFS089B09+ TTAAACACCTCAAGCTCCGTCATCCCACCCAAGATCTCCCCGGGGAAGTCACCGGAAAAA
JMFS056F02+ TTAAACACCTCAAGCTCCGTCATCCCACCCAAGATCTCCCCGGGGAAGTCACCGGAAAAA
JMFS069G08+ TTAAACACCTCAAGCTCCGTCATCCCACCCAAGATCTCCCCGGGGAAGTCACCGGAAAAA
JMFS048G09+ TTAAACACCTCAAGCTCCGTCATCCCACCCAAGATCTCCCCGGGGAAGTCACCGGAAAAA
JMFS136F12+ TCATCCCACCCAAGATCTCCCCGGGGAAGTCACCGGAAANA
JMFS060C08+ TCATCCCACCCAAGATCTCNCCGGGGAAGTCACCGGAANAA
JMFS026C04+ GTCATCCCACCCAAGATCTCNCCGGGGAAGTCACCGG-AAAA
JMFF042A21+ TTAAACACCTCAAGCTCCGTCATCCCACCCAAGATCTCCCCGGGGAAGTCACCGGAAAAA
JMFS142A12+ TTAAACACCTCAAGCTCCGTCATCCCACCCAAGATCTCCCCGGGGAAGTCACCGGAAAAA
JMFS102F06+ TTAAACACCTCAAGCTCCGTCATCCCACCCAAGATCTCCCCGGGGAAGTCACCGGAAAAA
JMFS068B01+ TTAAACACCTCAAGCTCCGTCATCCCACCCAAGATCTCCCCGGGGAAGTCACCGGAAAAA
JMFS040D05+ TTAAACACCTCAAGCTCCGTCATCCCACCCAAGATCTCCCCGGGGAAGTCACCGGAAAAA
                      ____________________________________________________________
consensus TTAAACACCTCAAGCTCCGTCATCCCACCCAAGATCTCCCCGGGGAAGTCACCGGAAAAA
 
. : . : . : . : . : . :
JMFS077A07+ TTATTATTCATCAGAACAATAACTTTCACCGCCGCGAGC
JMFS064D12+ TTATTATTCATCAGAACAATAACTTTCACCGCCGCGAGCTTCCCCATCTCCGGCGGCAGC
JMFS072E02+ TTATTATTCATCAGAACAATAACTTTCACCGCCGCGAGCTTCCCCATCTCCGGCGGCAGC
JMFS089B09+ TTATTATTCATCAGAACAATAACTTTCACCGCCGCGAGCTTCCCCATCTCCGGCGGCAGC
JMFS056F02+ TTATTATTCATCAGAACAATAACTTTCACCGCCGCGAGCTTCCCCATCTCCGGCGGCAGC
JMFS069G08+ TTATTATTCATCAGAACAATAACTTTCACCGCCGCGAGCTTCCCCATCTCCGGCGGCAGC
JMFS048G09+ TTATTATTCATCAGAACAATAACTTTCACCGCCGCGAGCTTCCCCATCTCCGGCGGCAGC
JMFS136F12+ TTATTATTCATCAGAACAATAACTTTCACCGCCGCGAGCTTCCCCATCTCCGGCGGCAGC
JMFS060C08+ TTATTATTCATCAGAACAATAACTTTCACCGCCGCGAGCTTCCCCATCTCCGGCGGCAGC
JMFS026C04+ TTATTATTCATCAGAACAATAACTTTCACCGCCGCGAGCTTCCCCATCTCCGGCGGCAGC
JMFF042A21+ TTATTATTCATCAGAACAATAACTTTCACCGCCGCGAGCTTCCCCATCTCCGGCGGCAGC
JMFS142A12+ TTATTATTCATCAGAACAATAACTTTCACCGCCGCGAGCTTCCCCATCTCCGGCGGCAGC
JMFS102F06+ TTATTATTCATCAGAACAATAACTTTCACCGCCGCGAGCTTCCCCATCTCCGGCGGCAGC
JMFS068B01+ TTATTATTCATCAGAACAATAACTTTCACCGCCGCGAGCTTCCCCATCTCCGGCGGCAGC
JMFS040D05+ TTATTATTCATCAGAACAATAACTTTCACCGCCGCGAGCTTCCCCATCTCCGGCGGCAGC
                      ____________________________________________________________
consensus TTATTATTCATCAGAACAATAACTTTCACCGCCGCGAGCTTCCCCATCTCCGGCGGCAGC
 
. : . : . : . : . : . :
JMFS064D12+ TCCCCGGTGAGGTTGTCGTCGGCGAGAGTCAAGCTAACAAGCCGATCCAACAGCCCAATC
JMFS072E02+ TCCCCGGTGAGGTTGTCGTCGGCGAGAGTCAAGCTAACAAGCCGATCCAACAGCCCAATC
JMFS089B09+ TCCCCGGTGAGGTTGTCGTCGGCGAGAGTCAAGCTAACAAGCCGATCCAACAGCCCAATC
JMFS056F02+ TCCCCGGTGAGGTTGTCGTCGGCGAGAGTCAAGCTAACAAGCCGATCCAACAGCCCAATC
JMFS069G08+ TCCCCGGTGAGGTTGTCGTCGGCGAGAGTCAAGCTAACAAGCCGATCCAACAGCCCAATC
JMFS048G09+ TCCCCGGTGAGGTTGTCGTCGGCGAGAGTCAAGCTAACAAGCCGATCCAACAGCCCAATC
JMFS136F12+ TCCCCGGTGAGGTTGTCGTCGGCGAGAGTCAAGCTAACAAGCCGATCCAACAGCCCAATC
JMFS060C08+ TCCCCGGTGAGGTTGTCGTCGGCGAGAGTCAAGCTAACAAGCCGATCCAACAGCCCAATC
JMFS026C04+ TCCCCGGTGAGGTTGTCGTCGGCGAGAGTCAAGCTAACAAGCCGATCCAACAGCCCAATC
JMFF042A21+ TCCCCGGTGAGGTTGTCGTCGGCGAGAGTCAAGCTAACAAGCCGATCCAACAGCCCAATC
JMFS142A12+ TCCCCGGTGAGGTTGTCGTCGGCGAGAGTCAAGCTAACAAGCCGATCCAACAGCCCAATC
JMFS102F06+ TCCCCGGTGAGGTTGTCGTCGGCGAGAGTCAAGCTAACAAGCCGATCCAACAGCCCAATC
JMFS068B01+ TCCCCGGTGAGGTTGTCGTCGGCGAGAGTCAAGCTAACAAGCCGATCCAACAGCCCAATC
JMFS040D05+ TCCCCGGTGAGGTTGTCGTCGGCGAGAGTCAAGCTAACAAGCCGATCCAACAGCCCAATC
                      ____________________________________________________________
consensus TCCCCGGTGAGGTTGTCGTCGGCGAGAGTCAAGCTAACAAGCCGATCCAACAGCCCAATC
 
. : . : . : . : . : . :
JMFS064D12+ TCCGGCGGGAG
JMFS072E02+ TCCGGCGGGAGCGTGCCGAAGAGCGGAACACCAGAAATATTTATATCAACCACCCGCGAA
JMFS089B09+ TCCGGCGGGAGCGTGCCGAAGAGCGGAACACCAGAAATATTTATATCAACCACCCGCGAA
JMFS056F02+ TCCGGCGGGAGCGTGCCGAAGAGCGGAACACCAGAAATATTTATATCAACCACCCGCGAA
JMFS069G08+ TCCGGCGGGAGCGTGCCGAAGAGCGGAACACCAGAAATATTTATATCAACCACCCGCGAA
JMFS048G09+ TCCGGCGGGAGCGTGCCGAAGAGCGGAACACCAGAAATATTTATATCAACCACCCGCGAA
JMFS136F12+ TCCGGCGGGAGCGTGCCGAAGAGCGGAACACCAGAAATATTTATATCAACCACCCGCGAA
JMFS060C08+ TCCGGCGGGAGCGTGCCGAAGAGCGGAACACCAGAAATATTTATATCAACCACCCGCGAA
JMFS026C04+ TCCGGCGGGAGCGTGCCGAAGAACGGAACACCAGAAATATTTATATCAACCACCCGCGAA
JMFF042A21+ TCCGGCGGGAGCGTGCCGAAGAGCGGAACACCAGAAATATTTATATCAACCACCCGCGAA
JMFS142A12+ TCCGGCGGGAGCGTGCCGAAGAGCGGAACACCAGAAATATTTATATCAACCACCCGCGAA
JMFS102F06+ TCCGGCGGGAGCGTGCCGAAGAGCGGAACACCAGAAATATTTATATCAACCACCCGCGAA
JMFS068B01+ TCCGGCGGGAGCGTGCCGAAGAGCGGAACACCAGAAATATTTATATCAACCACCCGCGAA
JMFS040D05+ TCCGGCGGGAGCGTGCCGAAGAGCGGAACACCAGAAATATTTATATCAACCACCCGCGAA
                      ____________________________________________________________
consensus TCCGGCGGGAGCGTGCCGAAGAGCGGAACACCAGAAATATTTATATCAACCACCCGCGAA
 
. : . : . : . : . : . :
JMFS072E02+ TCCCCATCACACTTCACCCCGGAGAAGAAGCAATGCACGGCGGCGGCGGAGGCGGAGGTG
JMFS089B09+ TCCCCATCACACTTCACCCCGGAGAAGAAGCAATGCACGGCGGCGGCGGAGGCGGAGGTG
JMFS056F02+ TCCCCATCACACTTCACCCCGGAGAAGAAGCAATGCACGGCGGCGGCGGAGGCGGAGGTG
JMFS069G08+ TCCCCATCACACTTCACCCCGGAGAAGAAGCAATGCACGGCGGCGGCGGAGGCGGAGGTG
JMFS048G09+ TCCCCATCACACTTCACCCCGGAGAAGAAGCAATGCACGGCGGCGGCGGAGGCGGAGGTG
JMFS136F12+ TCCCCATCACACTTCACCCCGGAGAAGAAGCAATGCACGGCGGCGGCGGAGGCGGAGGTG
JMFS060C08+ TCCCCATCACACTTCACCCCGGAGAAGAAGCAATGCACGGCGGCGGCGGAGGCGGAGGTG
JMFS026C04+ TCCCCATCACACTTCACCCCGGAGAAGAAGCAATGCACGGCGGCGGCGGAGGCGGAGGTG
JMFF042A21+ TCCCCATCACACTTCACCCCGGAGAAGAAGCAATGCACGGCGGCGGCGGAGGCGGAGGTG
JMFS142A12+ TCCCCATCACACTTCACCCCGGAGAAGAAGCAATGCACGGCGGCGGCGGAGGCGGAGGTG
JMFS102F06+ TCCCCATCACACTTCACCCCGGAGAAGAAGCAATGCACGGCGGCGGCGGAGGCGGAGGTG
JMFS068B01+ TCCCCATCACACTTCACCCCGGAGAAGAAGCAATGCACGGCGGCGGCGGAGGCGGAGGTG
JMFS040D05+ TCCCCATCACACTTCACCCCGGAGAAGAAGCAATGCACGGCGGCGGCGGAGGCGGAGGTG
JMSF001K24+ CCATCACACTTCACCCCGGAGAAGAAGCAATGCACGGCGGCGGCGGAGGCGGAGGTG
                      ____________________________________________________________
consensus TCCCCATCACACTTCACCCCGGAGAAGAAGCAATGCACGGCGGCGGCGGAGGCGGAGGTG
 
. : . : . : . : . : . :
JMFS072E02+ GCGTTGCCCACGTCTTTCCAATCACTCAGCCCGGAGCTCCGCGGCTTGACCATGGAAGCC
JMFS089B09+ GCGTTGCCCACGTCTTTCCAATCACTCAGCCCGGAGCTCCGCGGCTTGACCATGGAAGCC
JMFS056F02+ GCGTTGCCCACGTCTTTCCAATCACTCAGCCCGGAGCTCCGCGGCTTGACCATGGAAGCC
JMFS069G08+ GCGTTGCCCACGTCTTTCCAATCACTCAGCCCGGAGCTCCGCGGCTTGACCATGGAAGCC
JMFS048G09+ GCGTTGCCCACGTCTTTCCAATCACTCAGCCCGGAGCTCCGCGGCTTGACCATGGAAGCC
JMFS136F12+ GCGTTGCCCACGTCTTTCCAATCACTCAGCCCGGAGCTCCGCGGCTTGACCATGGAAGCC
JMFS060C08+ GCGTTGCCCACGTCTTTCCAATCACTCAGCCCGGAGCTCCGCGGCTTGACCATGGAAGCC
JMFS026C04+ GCGTTGCCCACGTCTTTCCAATCACTCAGCCCGGAGCTCCGCGGCTTGACCATGGAAGCC
JMFF042A21+ GCGTTGCCCACGTCTTTCCAATCACTCAGCCCGGAGCTCCGCGGCTTGACCATGGAAGCC
JMFS142A12+ GCGTTGCCCACGTCTTTCCAATCACTCAGCCCGGAGCTCCGCGGCTTGACCATGGAAGCC
JMFS102F06+ GCGTTGCCCACGTCTTTCCAATCACTCAGCCCGGAGCTCCGCGGCTTGACCATGGAAGCC
JMFS068B01+ GCGTTGCCCACGTCTTTCCAATCACTCAGCCCGGAGCTCCGCGGCTTGACCATGGAAGCC
JMFS040D05+ GCGTTGCCCACGTCTTTCCAATCACTCAGCCCGGAGCTCCGCGGCTTGACCATGGAAGCC
JMSF001K24+ GCGTTGCCCACGTCTTTCCAATCACTCAGCCCGGAGCTCCGCGGCTTGACCATGGAAGCC
                      ____________________________________________________________
consensus GCGTTGCCCACGTCTTTCCAATCACTCAGCCCGGAGCTCCGCGGCTTGACCATGGAAGCC
 
. : . : . : . : . : . :
JMFS072E02+ TTAAGCTTCAGCAGCACGTCAATATCAGAAGAGTAGGCATGGAGAATGGAAGTGGAAAAC
JMFS089B09+ TTAAGCTTCAGCAGCACGTCAATATCAGAAGAGTAGGCATGGAGAATGGAAGTGGAAAAC
JMFS056F02+ TTAAGCTTCAGCAGCACGTCAATATCAGAAGAGTAGGCATGGAGAATGGAAGTGGAAAAC
JMFS069G08+ TTAAGCTTCAGCAGCACGTCAATATCAGAAGAGTAGGCATGGAGAATGGAAGTGGAAAAC
JMFS048G09+ TTAAGCTTCAGCAGCACGTCAATATCAGAAGAGTAGGCATGGAGAATGGAAGTGGAAAAC
JMFS136F12+ TTAAGCTTCAGCAGCACGTCAATATCAGAAGAGTAGGCATGGAGAATGGAAGTGGAAAAC
JMFS060C08+ TTAAGCTTCAGCAGCACGTCAATATCAGAAGAGTAGGCATGGAGAATGGAAGTGGAAAAC
JMFS026C04+ TTAAGCTTCAGCAGCACGTCAATATCAGAAGAGTAGGCATGGAGAATGGAAGTGGAAAAC
JMFF042A21+ TTAAGCTTCAGCAGCACGTCAATATCAGAAGAGTAGGCATGGAGAATGGAAGTGGAAAAC
JMFS142A12+ TTAAGCTTCAGCAGCACGTCAATATCAGAAGAGTAGGCATGGAGAATGGAAGTGGAAAAC
JMFS102F06+ TTAAGCTTCAGCAGCACGTCAATATCAGAAGAGTAGGCATGGAGAATGGAAGTGGAAAAC
JMFS068B01+ TTAAGCTTCAGCAGCACGTCAATATCAGAAGAGTAGGCATGGAGAATGGAAGTGGAAAAC
JMFS040D05+ TTAAGCTTCAGCAGCACGTCAATATCAGAAGAGTAGGCATGGAGAATGGAAGTGGAAAAC
JMSF001K24+ TTAAGCTTCAGCAGCACGTCAATATCAGAAGAGTAGGCATGGAGAATGGAAGTGGAAAAC
                      ____________________________________________________________
consensus TTAAGCTTCAGCAGCACGTCAATATCAGAAGAGTAGGCATGGAGAATGGAAGTGGAAAAC
 
. : . : . : . : . : . :
JMFS072E02+ AGGAAGAAGAAAAGAGAGAAAGAAGAATAATGCATCTTAAGCTTTTGGAGTGTTATCAA
JMFS089B09+ AGGAAGAAGAAAAGAGAGAAAGAAGAATAATGCATCTTAAGCTTTTGGAGTGT
JMFS056F02+ AGGAAGAAGAAAAGAGAGAAAGAAGAATAATGCATCTTAAGCTTTTGGAGTGTTATC
JMFS069G08+ AGGAAGAAGAAAAGAGAGAAAGAAGAATAATGCATCTTAAGCTTTTGGAGTGT
JMFS048G09+ AGGAAGAAGAAAAGAGAGAAAGAAGAATAATGCATCTTAAGCTT
JMFS136F12+ AGGAAGAAGAAAAG
JMFS060C08+ AGGAAGAAGAAAAG
JMFS026C04+ AGGAAGAAGAAAAG
JMFF042A21+ AGGAAGAAGAAAAGAGAGAAAGAAGAATAATGCATCTTAAGCTTTTGGAGTGTTATCAAT
JMFS142A12+ AGGAAGAAGAAAAGAGAGAAAGAAGAATAATGCATCTTAAGCTTTTGGAGTGTTATCAAT
JMFS102F06+ AGGAAGAAGAAAAGAGAGAAAGAAGAATAATGCATCTTAAGCTTTTGGAGTGTTATCAAT
JMFS068B01+ AGGAAGAAGAAAAGAGAGAAAGAAGAATAATGCATCTTAAGCTTTTGGAGTGTTATCAAT
JMFS040D05+ AGGAAGAAGAAAAGAGAGAAAGAAGAATAATGCATCTTAAGCTTTTGGAGTGTTATCAAT
JMSF001K24+ AGGAAGAAGAAAAGAGAGAAAGAAGAATAATGCATCTTAAGCTTTTGGAGTGTTATCAAT
                      ____________________________________________________________
consensus AGGAAGAAGAAAAGAGAGAAAGAAGAATAATGCATCTTAAGCTTTTGGAGTGTTATCAAT
 
. : . : . : . : . : . :
JMFF042A21+ GGCGGCTTAGCT
JMFS142A12+ GGCGGCTTAGCTGGAGATTG
JMFS102F06+ GGCGGCTTAGCTGGAGATTGGGGAACCAAGAATTGAAGA
JMFS068B01+ GGCGGCTTAGCTGGAGATTGGGGAACCAAGAATT
JMFS040D05+ GGCGGCTTAGCTGGAGATTGGGGAACCAAGAATTGAAGA
JMSF001K24+ GGCGGCTTAGCTGGAGATTGGGGAACCAAGAATTGAAGAGATATAAATGGGAGATTTGCC
                      ____________________________________________________________
consensus GGCGGCTTAGCTGGAGATTGGGGAACCAAGAATTGAAGAGATATAAATGGGAGATTTGCC