Previous Contig 004335:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS151C04Sequence597004335 (3)pir|A96722|A967228e-35unknown protein T17F3.2 [imported] - Arabidopsis thaliana>gb:AE005173_894579 Ara
JMSF001K11Sequence289004335 (3)pir|A96722|A967223e-11unknown protein T17F3.2 [imported] - Arabidopsis thaliana>gb:AE005173_894579 Ara728011159 (3)gb:AE016959_10234742e-06Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC05
JMSF001L11Sequence388004335 (3)pir|A96722|A967223e-20unknown protein T17F3.2 [imported] - Arabidopsis thaliana>gb:AE005173_894579 Ara725011159 (3)gb:AE016959_10234744e-06Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC05

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS151C04+ CTAGCAAATATCCTAAAGCCAGAATGCTCA
                      ____________________________________________________________
consensus CTAGCAAATATCCTAAAGCCAGAATGCTCA
 
. : . : . : . : . : . :
JMFS151C04+ ACCATAGCCAAAGGATAGCCATGTAATATGATCATGCGAGCAAGATCAAGCCGACTCCTT
                      ____________________________________________________________
consensus ACCATAGCCAAAGGATAGCCATGTAATATGATCATGCGAGCAAGATCAAGCCGACTCCTT
 
. : . : . : . : . : . :
JMFS151C04+ CTGTTATCAAAATTAAAACTTCCACCTTCAATCCCATCTTTTACGCAGTTTTGATCTAGC
                      ____________________________________________________________
consensus CTGTTATCAAAATTAAAACTTCCACCTTCAATCCCATCTTTTACGCAGTTTTGATCTAGC
 
. : . : . : . : . : . :
JMFS151C04+ TTAGTTCTTACAATGCTGACTGCTTCATCATTTCCGTGCTCTTGATCAAAACTAAAATTT
                      ____________________________________________________________
consensus TTAGTTCTTACAATGCTGACTGCTTCATCATTTCCGTGCTCTTGATCAAAACTAAAATTT
 
. : . : . : . : . : . :
JMFS151C04+ GCAACAGCAAAAGTTGTTTCCTTTCTCTTGCCCCTCGTTAGCAACTGGCTTATGTCTTGG
JMSF001L11+ CCTCGTTAGCAACTGGCTTATGTCTTGG
                      ____________________________________________________________
consensus GCAACAGCAAAAGTTGTTTCCTTTCTCTTGCCCCTCGTTAGCAACTGGCTTATGTCTTGG
 
. : . : . : . : . : . :
JMFS151C04+ TTAGATCTTCTTCTACATCTGATTAAATGATTCCTCAAATGCGAAGTTCCACTGGTACTT
JMSF001L11+ TTAGATCTTCTTCTACATCTGATTAAATGATTCCTCAAATGCGAAGTTCCACTGGTACTT
                      ____________________________________________________________
consensus TTAGATCTTCTTCTACATCTGATTAAATGATTCCTCAAATGCGAAGTTCCACTGGTACTT
 
. : . : . : . : . : . :
JMFS151C04+ GACCCACTAAGTTTCCTATTACAGTGCCTACAAATAGCTATGAAAGTATCACCTTTCCTG
JMSF001L11+ GACCCACTAAGTTTCCTATTACAGTGCCTACAAATAGCTATGAAAGTATCACCTTTCCTG
JMSF001K11+ TTTCCTATTACAGTGCCTACAAATAGCTATGAAAGTATCACCTTTCCTG
                      ____________________________________________________________
consensus GACCCACTAAGTTTCCTATTACAGTGCCTACAAATAGCTATGAAAGTATCACCTTTCCTG
 
. : . : . : . : . : . :
JMFS151C04+ ACCCTATCAAAATCATTCCAAACGACTGATTTCAGTCTACTAGAATTGACTATGACCGAC
JMSF001L11+ ACCCTATCAAAATCATTCCAAACGACTGATTTCAGTCTACTAGAATTGACTATGACCGAC
JMSF001K11+ ACCCTATCAAAATCATTCCAAACGACTGATTTCAGTCTACTAGAATTGACTATGACCGAC
                      ____________________________________________________________
consensus ACCCTATCAAAATCATTCCAAACGACTGATTTCAGTCTACTAGAATTGACTATGACCGAC
 
. : . : . : . : . : . :
JMFS151C04+ TCATCTGCTATCTCCATTGCTTTCCTGATACTCTACCAACACCTGGGTTAGGGTTTGTTC
JMSF001L11+ TCATCTGCTATCTCCATTGCTTTCCTGATACTCTACCAACACCTGGGTTAGGGTTTGTTC
JMSF001K11+ TCATCTGCTATCTCCATTGCTTTCCTGATACTCTACCAACACCTGGGTTAGGGTTTGTTC
                      ____________________________________________________________
consensus TCATCTGCTATCTCCATTGCTTTCCTGATACTCTACCAACACCTGGGTTAGGGTTTGTTC
 
. : . : . : . : . : . :
JMFS151C04+ CACAGCTGTTCAGGCATGTGTGTAGTAAATACGAGTGAGTAAGTGTTTGTGTGAGCGAGA
JMSF001L11+ CACAGCTGTTCAGGCATGTGTGTAGTAAATACGAGTGAGTAAGTGTTTGTGTGAGCGAGA
JMSF001K11+ CACAGCTGTTCAGGCATGTGTGTAGTAAATACGAGTGAGTAAGTGTTTGTGTGAGCGAGA
                      ____________________________________________________________
consensus CACAGCTGTTCAGGCATGTGTGTAGTAAATACGAGTGAGTAAGTGTTTGTGTGAGCGAGA
 
. : . : . : . : . : . :
JMFS151C04+ AAGAGCGAGCGAGCGAGCGAGAGAGAA
JMSF001L11+ AAGAGCGAGCGAGCGAGCGAGAGAGAAACGGTTTGGTTAAGCGAGATATGTGTCAGCGTC
JMSF001K11+ AAGAGCGAGCGAGCGAGCGAGAGAGAAACGGTTTGGTTAAGCGAGATATGTGTCAGCGTC
                      ____________________________________________________________
consensus AAGAGCGAGCGAGCGAGCGAGAGAGAAACGGTTTGGTTAAGCGAGATATGTGTCAGCGTC