Previous Contig 004322:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001H13Sequence428004322 (5)gb:AB006701_15099321e-04Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOP9.727012925 (5)gb:AB015476_15125972e-41Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNC6.>gb:AY091118_15743
JMSF013E16Sequence451004322 (5)gb:AB006701_15099321e-04Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOP9.756012925 (5)gb:AB015476_15125972e-43Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNC6.>gb:AY091118_15743
JMSF032P23Sequence661004322 (5)gb:AB013387_15120203e-07Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K18G13.575012925 (5)gb:AY064059_15659971e-26Arabidopsis thaliana unknown protein (At1g64610) mRNA, complete cds.>gb:AY096369
JMSF033J17Sequence617004322 (5)gb:AB013387_15120202e-07Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K18G13.658012925 (5)gb:AB015476_15125971e-26Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNC6.>gb:AY091118_15743
JMSF034D23Sequence529004322 (5)gb:AB015476_15125973e-04Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNC6.>gb:AY091118_15743618012925 (5)gb:AY064059_15659972e-27Arabidopsis thaliana unknown protein (At1g64610) mRNA, complete cds.>gb:AY096369

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF033J17+ CCCCAA
JMSF032P23+ TTCTTTCTCATGGTATCAACAATTCGAAATCCCTCTGAATCTTTCCCCAA
                      ____________________________________________________________
consensus TTCTTTCTCATGGTATCAACAATTCGAAATCCCTCTGAATCTTTCCCCAA
 
. : . : . : . : . : . :
JMSF033J17+ TAATCGCTGAACCAACGATGAAGAGCCTAACCGGCTAACTGTACCATCCTGACCCAACTC
JMSF032P23+ TAATCGCTGAACCAACGATGAAGAGCCTAACCGGCTAACTGTACCATCCTGACCCAACTC
                      ____________________________________________________________
consensus TAATCGCTGAACCAACGATGAAGAGCCTAACCGGCTAACTGTACCATCCTGACCCAACTC
 
. : . : . : . : . : . :
JMSF033J17+ ATCAACCATGAACTCTGTTCCATTGTCCAGATTCCTAATTTTCTCCTCCAGAGAATCGTT
JMSF032P23+ ATCAACCATGAACTCTGTTCCATTGTCCAGATTCCTAATTTTCTCCTCCAGAGAATCGTT
                      ____________________________________________________________
consensus ATCAACCATGAACTCTGTTCCATTGTCCAGATTCCTAATTTTCTCCTCCAGAGAATCGTT
 
. : . : . : . : . : . :
JMSF033J17+ CTCGTCTGATTGGGAAGATCGACCCGAGAAGAAATGGTCCTCGGAATCCGAGTTTGCCAG
JMSF032P23+ CTCGTCTGATTGGGAAGATCGACCCGAGAAGAAATGGTCCTCGGAATCCGAGTTTGCCAG
JMSF034D23+ GATTGGGAAGATCGACCCGAGAAGAAATGGTCCTCGGAATCCGAGTTTGCCAG
                      ____________________________________________________________
consensus CTCGTCTGATTGGGAAGATCGACCCGAGAAGAAATGGTCCTCGGAATCCGAGTTTGCCAG
 
. : . : . : . : . : . :
JMSF033J17+ CATGGCCTCACCATTGTCACTAATCCTATTATCATCCCCAGCTTTGAACTTATCACAACA
JMSF032P23+ CATGGCCTCACCATTGTCACTAATCCTATTATCATCCCCAGCTTTGAACTTATCACAACA
JMSF034D23+ CATGGCCTCACCATTGTCACTAATCCTATTATCATACCCAGCTTTGAACTTATCACAACA
JMSF013E16+ TATCATCCCCAGCTTTGAACTTATCACAACA
JMSF001H13+ TCACAACA
                      ____________________________________________________________
consensus CATGGCCTCACCATTGTCACTAATCCTATTATCATCCCCAGCTTTGAACTTATCACAACA
 
. : . : . : . : . : . :
JMSF033J17+ TTCATCATTCAATTCATCTCTATTCATTACTTCCCATTCAGGACTCAATCCCATCCATTT
JMSF032P23+ TTCATCATTCAATTCATCTCTATTCATTACTTCCCATTCAGGACTCAATCCCATCCATTT
JMSF034D23+ TTCATCATTCAATTCATCTCTATTCATTACTTCCCATTCAGGACTCAATCCCATCCATTT
JMSF013E16+ TTCATCATTCAATTCATCTCTATTCATTACTTCCCATTCAGGACTCAATCCCATCCATTT
JMSF001H13+ TTCATCATTCAATTCATCTCTATTCATTACTTCCCATTCAGGACTCAATCCCATCCATTT
                      ____________________________________________________________
consensus TTCATCATTCAATTCATCTCTATTCATTACTTCCCATTCAGGACTCAATCCCATCCATTT
 
. : . : . : . : . : . :
JMSF033J17+ CAAAAGCCTAGTTCGCCGTTCACTCACACTTTCTAAGTTCTTCGCCCAGAATTCATAACC
JMSF032P23+ CAAAAGCCTAGTTCGCCGTTCACTCACACTTTCTAAGTTCTTCGCCCAGAATTCATAACC
JMSF034D23+ CAAAAGCCTAGTTNGCCGTTCACTCACACTTTNTAAGTTNTTCGCCCAGAATTCATAACC
JMSF013E16+ CAAAAGCCTAGTTCGCCGTTCACTCACACTTTCTAAGTTCTTCGCCCAGAATTCATAACC
JMSF001H13+ CAAAAGCCTAGTTCGCCGTTCACTCACACTTTCTAAGTTCTTCGCCCAGAATTCATAACC
                      ____________________________________________________________
consensus CAAAAGCCTAGTTCGCCGTTCACTCACACTTTCTAAGTTCTTCGCCCAGAATTCATAACC
 
. : . : . : . : . : . :
JMSF033J17+ TAAAGAACCAGAACTAGTATAAAAACAATCAGACAAAGAACTTATCTCATCACCAGTGTC
JMSF032P23+ TAAAGAACCAGAACTAGTATAAAAACAATCAGACAAAGAACTTATCTCATCACCAGTGTC
JMSF034D23+ TAAAGAACCAGAACTAGTATAAAAACAATCAGACAAAGAACTTATCTCATCACCAGTGTC
JMSF013E16+ TAAAGAACCAGAACTAGTATAAAAACAATCAGACAAAGAACTTATCTCATCACCAGTGTC
JMSF001H13+ TAAAGAACCAGAACTAGTATAAAAACAATCAGACAAAGAACTTATCTCATCACCAGTGTC
                      ____________________________________________________________
consensus TAAAGAACCAGAACTAGTATAAAAACAATCAGACAAAGAACTTATCTCATCACCAGTGTC
 
. : . : . : . : . : . :
JMSF033J17+ AAAGAACTGATCCTCGTTTCTTTCGCCACAACTTCCCATCATTCCTTAAACCTTAAAATC
JMSF032P23+ AAAGAACTGATCCTCGTTTCTTTCGCCACAACTTCCCATCATTCCTTAAACCTTAAAATC
JMSF034D23+ AAAGAACTGATCCTCGTTTCTTTCGCCACAACTTCCCATCATTCCTTAAACCTTAAAATC
JMSF013E16+ AAAGAACTGATCCTCGTTTCTTTCGCCACAACTTCCCATCATTCCTTAAACCTTAAAATC
JMSF001H13+ AAAGAACTGATCCTCGTTTCTTTCGCCACAACTTCCCATCATTCCTTAAACCTTAAAATC
                      ____________________________________________________________
consensus AAAGAACTGATCCTCGTTTCTTTCGCCACAACTTCCCATCATTCCTTAAACCTTAAAATC
 
. : . : . : . : . : . :
JMSF033J17+ CTCAATTTTCCATAAATTACGAGAACTAGAAACACAGTTCGCCTTNTTAGTCCTCGAATA
JMSF032P23+ CTCAATTTTCCATAAATTACGAGAACTAGAAACACAGTTCGCCTTCTTAGTCCTCGAATA
JMSF034D23+ CTCAATTTTCCATAAATTACGAGAACTNGAAACACAGTTCGCCTTNTTAGTCCTCGAATA
JMSF013E16+ CTCAATTTTCCATAAATTACGAGAACTAGAAACACAGTTCGCCTTNTTAGTCCTCGAATA
JMSF001H13+ CTCAATTTTCCATAAATTACGAGAACTAGAAACACAGTTCGCCTTCTTAGTCCTCGAATA
                      ____________________________________________________________
consensus CTCAATTTTCCATAAATTACGAGAACTAGAAACACAGTTCGCCTTCTTAGTCCTCGAATA
 
. : . : . : . : . : . :
JMSF033J17+ CCACGAAAAAGGGAACATGCAGAAAGAAAAAAAAACACGAAATTTGGGAGTAGAACAAAC
JMSF032P23+ CCACGAAAAAGGGAACATGCAGAAAGAAAAAAAAACACGAAATTTGGGAGTAGAACAAAC
JMSF034D23+ CCACGAAAAAGGGAACATGCAGAAAGAAAAAAAAACACGAAATTTGGGAGTAGAACAAAC
JMSF013E16+ CCACGAAAAAGGGAACATGCAGAAAGAAAAAAAAACACGAAATTTGGGAGTAGAACAAAC
JMSF001H13+ CCACGAAAAAGGGAACATGCAGAAAGAAAAAAAAACACGAAATTTGGGAGTAGAACAAAC
                      ____________________________________________________________
consensus CCACGAAAAAGGGAACATGCAGAAAGAAAAAAAAACACGAAATTTGGGAGTAGAACAAAC
 
. : . : . : . : . : . :
JMSF033J17+ GAGTCAAAC
JMSF032P23+ GAGTCAAAC
JMSF034D23+ GAGTCAAACTGGAATTTATAACAAAAATGGCGAAAGGATCAACGGGTGTGTC
JMSF013E16+ GAGTCAAACTGGAATTTATAACAAAAATGGCGAAAGGATCAACGGGTGTGTC
JMSF001H13+ GAGTCAAACTGGAATTTATAACAAAAATGGCGAAAGGATCAACGGGTGTGTCTCCGACCC
                      ____________________________________________________________
consensus GAGTCAAACTGGAATTTATAACAAAAATGGCGAAAGGATCAACGGGTGTGTCTCCGACCC