Previous Contig 004313:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS138H05Sequence614004313 (2)pir|S51529|S515297e-49SPF1 protein - sweet potato>gb:IPBSPF1P_1683201 Ipomoea batatas mRNA for SPF1 pr
JMSF001F18Sequence487004313 (2)pir|S51529|S515298e-21SPF1 protein - sweet potato>gb:IPBSPF1P_1683201 Ipomoea batatas mRNA for SPF1 pr751021970pir|S51529|S515296e-57SPF1 protein - sweet potato>gb:IPBSPF1P_1683201 Ipomoea batatas mRNA for SPF1 pr

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS138H05+ CGAGTGGTTTGAGGCATAGGATGGTTGTG
                      ____________________________________________________________
consensus CGAGTGGTTTGAGGCATAGGATGGTTGTG
 
. : . : . : . : . : . :
JMFS138H05+ AGAGCCTTTGTAGACAATCTCAGTAATCTCACCTTCTAAGGATGTCTCGACCTTCTTCCT
                      ____________________________________________________________
consensus AGAGCCTTTGTAGACAATCTCAGTAATCTCACCTTCTAAGGATGTCTCGACCTTCTTCCT
 
. : . : . : . : . : . :
JMFS138H05+ GGTGGAACAGTTTGGGTGTGTACACTTGTAATAACTTGTTGGATTCTGGCTTCTCTTCAC
JMSF001F18+ CTCTTCAC
                      ____________________________________________________________
consensus GGTGGAACAGTTTGGGTGTGTACACTTGTAATAACTTGTTGGATTCTGGCTTCTCTTCAC
 
. : . : . : . : . : . :
JMFS138H05+ CTGTTTCTGCCCATATTTTCTCCAGTTATACCCATCATCTGACCTCCTTAATGCTTGGTT
JMSF001F18+ CTGTTTCTGCCCATA-TTTCTCCAGTTATACCCATCATCTGACCTCCTTAATGCTTGGTT
                      ____________________________________________________________
consensus CTGTTTCTGCCCATATTTTCTCCAGTTATACCCATCATCTGACCTCCTTAATGCTTGGTT
 
. : . : . : . : . : . :
JMFS138H05+ TTGGTGATTGTAATCTGAACAATTTCCGCCATTGCTTTGAGGGTTAGTAAGGAAAGAGAA
JMSF001F18+ TTGGTGATTGTAATCTGAACAATTTCCGCCATTGCTTTGAGGGTTAGTAAGGAAAGAGAA
                      ____________________________________________________________
consensus TTGGTGATTGTAATCTGAACAATTTCCGCCATTGCTTTGAGGGTTAGTAAGGAAAGAGAA
 
. : . : . : . : . : . :
JMFS138H05+ ATCTGAAAAGCCGCCATTGTCTTCCTGCTTCAGAGCTGCAGTGGTGTTCCAGTTGAAAGG
JMSF001F18+ ATCTGAAAAGCCGCCATTGTCTTCCTGCTTCAGAGCTGCAGTGGTGTTCCAGTTGAAAGG
                      ____________________________________________________________
consensus ATCTGAAAAGCCGCCATTGTCTTCCTGCTTCAGAGCTGCAGTGGTGTTCCAGTTGAAAGG
 
. : . : . : . : . : . :
JMFS138H05+ CTGAGCCGGAAAAGTTCCGGTGGTCGGAGAAGGCAAAAGATTGGAATCGGAGAGGAGAAC
JMSF001F18+ CTGAGCCGGAAAAGTTCCGGTGGTCGGAGAAGGCAAAAGATTGGAATCGGAGAGGAGAAC
                      ____________________________________________________________
consensus CTGAGCCGGAAAAGTTCCGGTGGTCGGAGAAGGCAAAAGATTGGAATCGGAGAGGAGAAC
 
. : . : . : . : . : . :
JMFS138H05+ CGGCGAGTCCAGGAGCTGGGTGGGGCTAGGAAGATTCGCAAAGTAAGAGGAAGGAGAGAG
JMSF001F18+ CGGCGAGTCCAGGAGCTGGGTGGGGCTAGGAAGATTCGCAAAGTAAGAGGAAGGAGAGAG
                      ____________________________________________________________
consensus CGGCGAGTCCAGGAGCTGGGTGGGGCTAGGAAGATTCGCAAAGTAAGAGGAAGGAGAGAG
 
. : . : . : . : . : . :
JMFS138H05+ AGGCAGAGAAGGCGGCGATAAAGACTTAAACTTGGGTGACGGCCCACTCCTCTCGCCGCC
JMSF001F18+ AGGCAGAGAAGGCGGCGATAAAGACTTAAACTTGGGTGACGGCCCACTCCTCTCGCCGCC
                      ____________________________________________________________
consensus AGGCAGAGAAGGCGGCGATAAAGACTTAAACTTGGGTGACGGCCCACTCCTCTCGCCGCC
 
. : . : . : . : . : . :
JMFS138H05+ GGCGGTGGCTGGGTAGACATCTCCGGCCAAAAGGTCGGTGAAGGAGGAAGAGGCAGTGGA
JMSF001F18+ GGCGGTGGCTGGGTAGACATCTCCGGCCAAAAGGTCGGTGAAGGAGGAAGAGGCAGTGGA
                      ____________________________________________________________
consensus GGCGGTGGCTGGGTAGACATCTCCGGCCAAAAGGTCGGTGAAGGAGGAAGAGGCAGTGGA
 
. : . : . : . : . : . :
JMFS138H05+ GTATACAGTCCCTGAAGAAGCAGCCATTACAGAGACGTAAACTAA
JMSF001F18+ GTATACAGTCCCTGAAGAAGCAGCCATTACAGAGACGTAAACTAAGGTGGAAGCCCTATC
                      ____________________________________________________________
consensus GTATACAGTCCCTGAAGAAGCAGCCATTACAGAGACGTAAACTAAGGTGGAAGCCCTATC