Previous Contig 004311:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034F07Sequence569004311 (11)pir|T51793|T517935e-63hypothetical protein T5K6_30 - Arabidopsis thaliana>gb:ATT5K6_1556196 Arabidopsi748009813 (7)pir|T51793|T517934e-66hypothetical protein T5K6_30 - Arabidopsis thaliana>gb:ATT5K6_1556196 Arabidopsi
JMFS077G06Sequence627004311 (11)pir|T51793|T517936e-73hypothetical protein T5K6_30 - Arabidopsis thaliana>gb:ATT5K6_1556196 Arabidopsi
JMFS090C01Sequence620004311 (11)pir|T51793|T517933e-78hypothetical protein T5K6_30 - Arabidopsis thaliana>gb:ATT5K6_1556196 Arabidopsi
JMFS112D11Sequence622004311 (11)pir|T51793|T517932e-72hypothetical protein T5K6_30 - Arabidopsis thaliana>gb:ATT5K6_1556196 Arabidopsi
JMFS156A07Sequence626004311 (11)pir|T51793|T517933e-79hypothetical protein T5K6_30 - Arabidopsis thaliana>gb:ATT5K6_1556196 Arabidopsi
JMSF001F12Sequence382004311 (11)pir|T51793|T517933e-29hypothetical protein T5K6_30 - Arabidopsis thaliana>gb:ATT5K6_1556196 Arabidopsi706009813 (7)pir|T51793|T517936e-65hypothetical protein T5K6_30 - Arabidopsis thaliana>gb:ATT5K6_1556196 Arabidopsi
JMSF016I20Sequence496004311 (11)pir|T51793|T517934e-44hypothetical protein T5K6_30 - Arabidopsis thaliana>gb:ATT5K6_1556196 Arabidopsi710009813 (7)pir|T51793|T517932e-63hypothetical protein T5K6_30 - Arabidopsis thaliana>gb:ATT5K6_1556196 Arabidopsi
JMSF024A02Sequence606004311 (11)pir|T51793|T517932e-66hypothetical protein T5K6_30 - Arabidopsis thaliana>gb:ATT5K6_1556196 Arabidopsi670009813 (7)pir|T51793|T517932e-57hypothetical protein T5K6_30 - Arabidopsis thaliana>gb:ATT5K6_1556196 Arabidopsi
JMSF030M03Sequence654004311 (11)pir|T51793|T517934e-81hypothetical protein T5K6_30 - Arabidopsis thaliana>gb:ATT5K6_1556196 Arabidopsi704009813 (7)pir|T51793|T517932e-64hypothetical protein T5K6_30 - Arabidopsis thaliana>gb:ATT5K6_1556196 Arabidopsi
JMSF042I19Sequence609004311 (11)pir|T51793|T517933e-66hypothetical protein T5K6_30 - Arabidopsis thaliana>gb:ATT5K6_1556196 Arabidopsi396009813 (7)pir|T51793|T517939e-39hypothetical protein T5K6_30 - Arabidopsis thaliana>gb:ATT5K6_1556196 Arabidopsi
JMSF052I04Sequence662004311 (11)pir|T51793|T517936e-84hypothetical protein T5K6_30 - Arabidopsis thaliana>gb:ATT5K6_1556196 Arabidopsi673009442 (12)sp|P25460|RS11_MAIZE2e-7240S ribosomal protein S11.>pir|S16577|S16577 ribosomal protein S11 - maize>gb:ZM

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052I04+ AAGAACCCATTTTTCAAATTCCATCAACAGTGAGGCAGCAA
JMFS090C01+ AACAGTGAGGCAGCAA
JMFS156A07+ AATTCCATCAACAGTGAGGCAGCAA
JMSF030M03+ TTTTCAAATTCCATCAACAGTGAGGCAGCAA
                      ____________________________________________________________
consensus AAGAACCCATTTTTCAAATTCCATCAACAGTGAGGCAGCAA
 
. : . : . : . : . : . :
JMSF052I04+ TATCTTGCATCATAGTTTGCAAGTGGAACTCCTGAGTCAGTCTATCTGCTGGTGGAAACA
JMFS090C01+ TATCTTGCATCATAGTTTGCAAGTGGAACTCCTGAGTCAGTCTATCTGCTGGTGGAAACA
JMFS156A07+ TATCTTGCATCATAGTTGNCAAGTGGAACTCCTGAGTCAGTCTATCTGCTGGTGGAAACA
JMSF030M03+ TATCTTGCATCATAGTTTGCAAGTGGAACTCCTGAGTCAGTCTATCTGCTGGTGGAAACA
JMFS112D11+ GCAAGTGGAACTCCTGAGTCAGTCTATCTGCTGGTGGAAACA
JMFS077G06+ TTTGCAAGTGGAACTCCTGAGTCAGTCTATCTGCTGGTGGAAACA
JMSF024A02+ GGTGGAAACA
JMSF042I19+ GGTGGAAACA
                      ____________________________________________________________
consensus TATCTTGCATCATAGTTTGCAAGTGGAACTCCTGAGTCAGTCTATCTGCTGGTGGAAACA
 
. : . : . : . : . : . :
JMSF052I04+ AAACTATGTTGCTGCCTTTGTAAGCATCATCCTCTAGCTGAGAATCTCCGGGGCAGAAGG
JMFS090C01+ AAACTATGTTGCTGCCTTTGTAAGCATCATCCTCTAGCTGAGAATCTCCGGGGCAGAAGG
JMFS156A07+ AAACTATGTTGCTGCCTTTGTAAGCATCATCCTCTAGCTGAGAATCTCCGGGGCAGAAGG
JMSF030M03+ AAACTATGTTGCTGCCTTTGTAAGCATCATCCTCTAGCTGAGAATCTCCGGGGCAGAAGG
JMFS112D11+ AAACTATGTTGCTGCCTTTGTAAGCATCATCCTCTAGCTGAGAATCTCCGGGGCAGAAGG
JMFS077G06+ AAACTATGTTGCTGCCTTTGTAAGCATCATCCTCTAGCTGAGAATCTCCGGGGCAGAAGG
JMFF034F07+ CTTTGTAAGCATCATCCTCTAGCTGAGAATCTCCGGGGCAGAAGG
JMSF024A02+ AAACTATGTTGCTGCCTTTGTAAGCATCATCCTCTAGCTGAGAATCTCCGGGGCAGAAGG
JMSF042I19+ AAACTATGTTGCTGCCTTTGTAAGCATCATCCTCTAGCTGAGAATCTCCGGGGCAGAAGG
                      ____________________________________________________________
consensus AAACTATGTTGCTGCCTTTGTAAGCATCATCCTCTAGCTGAGAATCTCCGGGGCAGAAGG
 
. : . : . : . : . : . :
JMSF052I04+ CGAAACAGCGTTGAACTAGTGAAGACGAGTAACCCTTACAGGAAACGTTAAATTGCTCGG
JMFS090C01+ CGAAACAGCGTTGAACTAGTGAAGACGAGTAACCCTTACAGGAAACGTTAAATTGCTCGG
JMFS156A07+ CGAAACAGCGTTGAACTAGTGAAGACGAGTAACCCTTACAGGAAACGTTAAATTGCTCGG
JMSF030M03+ CGAAACAGCGTTGAACTAGTGAAGACGAGTAACCCTTACAGGAAACGTTAAATTGCTCGG
JMFS112D11+ CGAAACAGCGTTGAACTAGTGAAGACGAGTAACCCTTACAGGAAACGTTAAATTGCTCGG
JMFS077G06+ CGAAACAGCGTTGAACTAGTGAAGACGAGTAACCCTTACAGGAAACGTTAAATTGCTCGG
JMFF034F07+ CGAAACAGCGTTGAACTAGTGAAGACGAGTAACCCTTACAGGAAACGTTAAATTGCTCGG
JMSF024A02+ CGAAACAGCGTTGAACTAGTGAAGACGAGTAACCCTTACAGGAAACGTTAAATTGCTCGG
JMSF042I19+ CGAAACAGCGTTGAACTAGTGAAGACGAGTAACCCTTACAGGAAACGTTAAATTGCTCGG
JMSF016I20+ AAACGTTAAATTGNTCGG
                      ____________________________________________________________
consensus CGAAACAGCGTTGAACTAGTGAAGACGAGTAACCCTTACAGGAAACGTTAAATTGCTCGG
 
. : . : . : . : . : . :
JMSF052I04+ CGACGGAATTGAGATCAGGAGACGAAGGGCAGTGGCAAATGCCAAGGACCGCGAGGATCT
JMFS090C01+ CGACGGAATTGAGATCAGGAGACGAAGGGCAGTGGCAAATGCCAAGGACCGCGAGGATCT
JMFS156A07+ CGACGGAATTGAGATCAGGAGACGAAGGGCAGTGGCAAATGCCAAGGACCGCGAGGATCT
JMSF030M03+ CGACGGAATTGAGATCAGGAGACGAAGGGCAGTGGCAAATGCCAAGGACCGCGAGGATCT
JMFS112D11+ CGACGGAATTGAGATCAGGAGACGAAGGGCAGTGGCAAATGCCAAGGACCGCGAGGATCT
JMFS077G06+ CGACGGAATTGAGATCAGGAGACGAAGGGCAGTGGCAAATGCCAAGGACCGCGAGGATCT
JMFF034F07+ CGACGGAATTGAGATCAGGAGACGAAGGGCAGTGGCAAATGCCAAGGACCGCGAGGATCT
JMSF024A02+ CGACGGAATTGAGATCAGGAGACGAAGGGCAGTGGCAAATGCCAAGGACCGCGAGGATCT
JMSF042I19+ CGACGGAATTGAGATCAGGAGACGAAGGGCAGTGGCAAATGCCAAGGACCGCGAGGATCT
JMSF016I20+ CGACGGAATTGAGATCAGGAGACGAAGGGCAGTGGCAAATGCCAAGGACCGCGAGGATC-
                      ____________________________________________________________
consensus CGACGGAATTGAGATCAGGAGACGAAGGGCAGTGGCAAATGCCAAGGACCGCGAGGATCT
 
. : . : . : . : . : . :
JMSF052I04+ TACGATTGGACTGGAAGTCCTCCCAAGGGCTAGCAGGAGAGCCGCCGGCCATGAACTTGA
JMFS090C01+ TACGATTGGACTGGAAGTCCTCCCAAGGGCTAGCAGGAGAGCCGCCGGCCATGAACTTGA
JMFS156A07+ TACGATTGGACTGGAAGTCCTCCCAAGGGCTAGCAGGAGAGCCGCCGGCCATGAACTTGA
JMSF030M03+ TACGATTGGACTGGAAGTCCTCCCAAGGGCTAGCAGGAGAGCCGCCGGCCATGAACTTGA
JMFS112D11+ TACGATTGGACTGGAAGTCCTCCCAAGGGCTAGCAGGAGAGCCGCCGGCCATGAACTTGA
JMFS077G06+ TACGATTGGACTGGAAGTCCTCCCAAGGGCTAGCAGGAGAGCCGCCGGCCATGAACTTGA
JMFF034F07+ TACGATTGGACTGGAAGTCCTCCCAAGGGCTAGCAGGAGAGCCGCCGGCCATGAACTTGA
JMSF024A02+ TACGATTGGACTGGAAGTCCTCCCAAGGGCTAGCAGGAGAGCCGCCGGCCATGAACTTGA
JMSF042I19+ TACGATTGGACTGGAAGTCCTCCCAAGGGCTAGCAGGAGAGCCNCCGGCCATGAACTTGA
JMSF016I20+ TACGATTGGACTGGAAGTCCTCCCAAGGGCTAGCAGGAGAGCCGCCGGCCATGAACTTGA
JMSF001F12+ AGAGCCGCCGGCCATGAACTTGA
                      ____________________________________________________________
consensus TACGATTGGACTGGAAGTCCTCCCAAGGGCTAGCAGGAGAGCCGCCGGCCATGAACTTGA
 
. : . : . : . : . : . :
JMSF052I04+ ACCGAAGGCTGCCGGAATCCCAAGGCTGGTGAGAGAAGGGAGACTTCTGGTGCTCCGTGT
JMFS090C01+ ACCGAAGGCTGCCGGAATCCCAAGGCTGGTGAGAGAAGGGAGACTTCTGGTGCTCCGTGT
JMFS156A07+ ACCGAAGGCTGCCGGAATCCCAAGGCTGGTGAGAGAAGGGAGACTTCTGGTGCTCCGTGT
JMSF030M03+ ACCGAAGGCTGCCGGAATCCCAAGGCTGGTGAGAGAAGGGAGACTTCTGGTGCTCCGTGT
JMFS112D11+ ACCGAAGGCTGCCGGAATCCCAAGGCTGGTGAGAGAAGGGAGACTTCTGGTGCTCCGTGT
JMFS077G06+ ACCGAAGGCTGCCGGAATCCCAAGGCTGGTGAGAGAAGGGAGACTTCTGGTGCTCCGTGT
JMFF034F07+ ACCGAAGGCTGCCGGAATCCCAAGGCTGGTGAGAGAAGGGAGACTTCTGGTGCTCCGTGT
JMSF024A02+ ACCGAAGGCTGCCGGAATCCCAAGGCTGGTGAGAGAAGGGAGACTTCTGGTGCTCCGTGT
JMSF042I19+ ACCGAAGGCTGCCGGAATCCCAAGGCTGGTGAGAGAAGGGAGACTTCTGGTGCTCCGTGT
JMSF016I20+ ACCGAAGGCTGCCGGAATCCCAAGGCTGGTGAGAGAAGGGAGACTTCTGGTGCTCCGTGT
JMSF001F12+ ACCGAAGGCTGCCGGAATCCCAAGGCTGGTGAGAGAAGGGAGACTTCTGGTGCTCCGTGT
                      ____________________________________________________________
consensus ACCGAAGGCTGCCGGAATCCCAAGGCTGGTGAGAGAAGGGAGACTTCTGGTGCTCCGTGT
 
. : . : . : . : . : . :
JMSF052I04+ AGAAGGAGCTGATGGAGGAGAGCGATACAGTGTGGTGGCGGACCAGCATGGAGGTGTAAT
JMFS090C01+ AGAAGGAGCTGATGGAGGAGAGCGATACAGTGTGGTGGCGGACCAGCATGGAGGTGTAAT
JMFS156A07+ AGAAGGAGCTGATGGAGGAGAGCGATACAGTGTGGTGGCGGACCAGCATGGAGGTGTAAT
JMSF030M03+ AGAAGGAGCTGATGGAGGAGAGCGATACAGTGTGGTGGCGGACCAGCATGGAGGTGTAAT
JMFS112D11+ AGAAGGAGCTGATGGAGGAGAGCGATACAGTGTGGTGGCGGACCAGCATGGAGGTGTAAT
JMFS077G06+ AGAAGGAGCTGATGGAGGAGAGCGATACAGTGTGGTGGCGGACCAGCATGGAGGTGTAAT
JMFF034F07+ AGAAGGAGCTGATGGAGGAGAGCGATACAGTGTGGTGGCGGACCAGCATGGAGGTGTAAT
JMSF024A02+ AGAAGGAGCTGATGGAGGAGAGCTATACAGTGTGGTGGCGGACCAGCATGGAGGTGTAAT
JMSF042I19+ AGAAGGAGCTGATGGAGGAGAGCGATACAGTGTGGTGGCGGACCAGCATGGAGGTGTAAT
JMSF016I20+ AGAAGGAGCTGATGGAGGAGAGCGATACAGTGTGGTGGCGGACCAGCATGGAGGTGTAAT
JMSF001F12+ AGAAGGAGCTGATGGAGGAGAGCGATACAGTGTGGTGGCGGACCAGCATGGAGGTGTAAT
                      ____________________________________________________________
consensus AGAAGGAGCTGATGGAGGAGAGCGATACAGTGTGGTGGCGGACCAGCATGGAGGTGTAAT
 
. : . : . : . : . : . :
JMSF052I04+ CTCGGAAGAGCGGGATCGGAATTGACCCGATTGGGAGCACCGCCACACGGATCATGCAGC
JMFS090C01+ CTCGGAAGAGCGGGATCGGAATTGACCCGATTGGGAGCACCGCCACACGGATCATGCAGC
JMFS156A07+ CTCGGAAGAGCGGGATCGGAATTGACCCGATTGGGAGCACCGCCACACGGATCATGCAGC
JMSF030M03+ CTCGGAAGAGCGGGATCGGAATTGACCCGATTGGGAGCACCGCCACACGGATCATGCAGC
JMFS112D11+ CTCGGAAGAGCGGGATCGGAATTGACCCGATTGGGAGCACCGCCACACGGATCATGCAGC
JMFS077G06+ CTCGGAAGAGCGGGATCGGAATTGACCCGATTGGGAGCACCGCCACACGGATCATGCAGC
JMFF034F07+ CTCGGAAGAGCGGGATCGGAATTGACCCGATTGGGAGCACCGCCACACGGATCATGCAGC
JMSF024A02+ CTCGGAAGAGCGGGATCGGAATTGACCCGATTGGGAGCACCGCCACACGGATCATGCAGC
JMSF042I19+ CTCGGAAGAGCGGGATCGGAATTGACCCGATTGGGAGCACCGCCACACGGATCATGCAGC
JMSF016I20+ CTCGGAAGAGCGGGATCGGAATTGACCCGATTGGGAGCACCGCCACACGGATCATGCAGC
JMSF001F12+ CTCGGAAGAGCGGGATCGGAATTGACCCGATTGGGAGCACCGCCACACGGATCATGCAGC
                      ____________________________________________________________
consensus CTCGGAAGAGCGGGATCGGAATTGACCCGATTGGGAGCACCGCCACACGGATCATGCAGC
 
. : . : . : . : . : . :
JMSF052I04+ TCGTCTCGATGCTCACATCCGGCTCCATTATTAGTGAGTCGGAAATCGGTGGACGGCGGC
JMFS090C01+ TCGTCTCGATGCTCACATCCGGCTCCATTATTAGTGAGTCGGAAATCGGTGGACGGCGGC
JMFS156A07+ TCGTCTCGATGCTCACATCCGGCTCCATTATTAGTGAGTCGGAAATCGGTGGACGGCGGC
JMSF030M03+ TCGTCTCGATGCTCACATCCGGCTCCATTATTAGTGAGTCGGAAATCGGTGGACGGCGGC
JMFS112D11+ TCGTCTCGATGCTCACATCCGGCTCCATTATTAGTGAGTCGGAAATCGGTGGACGGCGGC
JMFS077G06+ TCGTCTCGATGCTCACATCCGGCTCCATTATTAGTGAGTCGGAAATCGGTGGACGGCGGC
JMFF034F07+ TCGTCTCGATGCTCACATCCGGCTCCATTATTAGTGAGTCGGAAATCGGTGGACGGCGGC
JMSF024A02+ TCGTCTCGATGCTCACATCCGGCTCCATTATTAGTGAGTCGGAAATCGGTGGACGGCGGC
JMSF042I19+ TCGTCTNGATGCTCACATCCGGCTCCATTATTAGTGAGTCGGAAATCGGTGGACGGCGGC
JMSF016I20+ TCGTCTCGATGCTCACATCCGGCTCCATTATTAGTGAGTCGGAAATCGGTGGACGGCGGC
JMSF001F12+ TCGTCTCGATGCTCACATCCGGCTCCATTATTAGTGAGTCGGAAATCGGTGGACGGCGGC
                      ____________________________________________________________
consensus TCGTCTCGATGCTCACATCCGGCTCCATTATTAGTGAGTCGGAAATCGGTGGACGGCGGC
 
. : . : . : . : . : . :
JMSF052I04+ CGTAGCAAGGCGGCAGACGGTGGTGGAAAGGGAGATGAAACCGCTTAGCCCGTAGATCGC
JMFS090C01+ CGTAGCAAGGCGGCAGACGGTGGTGGAAAGGGAGATGAAACCGCTTAGCCCGTAGATCGC
JMFS156A07+ CGTAGCAAGGCGGCAGACGGTGGTGGAAAGGGAGATGAAACCGCTTAGCCCGTAGATCGC
JMSF030M03+ CGTAGCAAGGCGGCAGACGGTGGTGGAAAGGGAGATGAAACCGCTTAGCCCGTAGATCGC
JMFS112D11+ CGTAGCAAGGCGGCAGACGGTGGTGGAAAGGGAGATGAAACCGCTTAGCCCGTAGATCGC
JMFS077G06+ CGTAGCAAGGCGGCAGACGGTGGTGGAAAGGGAGATGAAACCGCTTAGCCCGTAGATCGC
JMFF034F07+ CGTAGCAAGGCGGCAGACGGTGGTGGAAAGGGAGATGAAACCGCTTAGCCCGTAGATCGC
JMSF024A02+ CGTAGCAAGGCGGCAGACGGTGGTGGAAAGGGAGATGAAACCGCTTAGCCCGTAGATCGC
JMSF042I19+ NGTAGCAAGGCGGCAGACGGTGGTGGAAAGGGAGATGAAACCGCTTAGCCCGTAGATCGC
JMSF016I20+ CGTAGCAAGGCGGCAGACGGTGGTGGAAAGGGAGATGAAACCGCTTAGCCCGTAGATCGC
JMSF001F12+ CGTAGCAAGGCGGCAGACGGTGGTGGAAAGGGAGATGAAACCGCTTAGCCCGTAGATCGC
                      ____________________________________________________________
consensus CGTAGCAAGGCGGCAGACGGTGGTGGAAAGGGAGATGAAACCGCTTAGCCCGTAGATCGC
 
. : . : . : . : . : . :
JMSF052I04+ GGAGTG-AACATTGCAGTTAC
JMFS090C01+ GGAG
JMFS156A07+ G
JMSF030M03+ GGAGTG-AACATTGCAGTTAC
JMFS112D11+ GGAGTG-AACATTGCAGTTACAGACTTGCAGATGCGGATCC
JMFS077G06+ GGAGTG-AACATTGCAGTTACAGACTTGCAGATGCGGATCCAA
JMFF034F07+ GGAGTG-AACATTGCAGTTACAGACTTGCAGATGCGGATCCAATT
JMSF024A02+ GGAGTGAAACATTGCAGTTACAGACTTGCAGATGCGGATCCAATTGTTTTTTGC
JMSF042I19+ GGAGTG-AACATTGCAGTTACAGACTTGCAGATGCGGATCCAATTGTTTTTTGC
JMSF016I20+ GGAGTG-AACATTGCAGTTACAGACTTGCAGATGCGGATCCAATTGTTTTTTGC
JMSF001F12+ GGAGTG-AACATTGCAGTTACAGACTTGCAGATGCGGATCCAATTGTTTTTTGCTAACTC
                      ____________________________________________________________
consensus GGAGTG-AACATTGCAGTTACAGACTTGCAGATGCGGATCCAATTGTTTTTTGCTAACTC