Previous Contig 004303:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN003B15Sequence617004303 (3)sp|O49204|KAPS_CATRO2e-42Adenylylsulfate kinase, chloroplast precursor (EC 2.7.1.25) (APS kinase) (Adenos
JMSF001E13Sequence343004303 (3)
JMSF015I16Sequence439004303 (3)751022658sp|O49204|KAPS_CATRO3e-77Adenylylsulfate kinase, chloroplast precursor (EC 2.7.1.25) (APS kinase) (Adenos

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN003B15+ ATGTTCTCTGTCCTATGCTTTGCTCCAAAG
                      ____________________________________________________________
consensus ATGTTCTCTGTCCTATGCTTTGCTCCAAAG
 
. : . : . : . : . : . :
JMFN003B15+ CTAAGATCACTATTTAGACCATGACGGAGATTGTCACCATCAAGAACATAAGTAAGCTTT
                      ____________________________________________________________
consensus CTAAGATCACTATTTAGACCATGACGGAGATTGTCACCATCAAGAACATAAGTAAGCTTT
 
. : . : . : . : . : . :
JMFN003B15+ CCCCGAGCATGTAAGCCTCCGCTTAGAGCACATGCCAAACTACTCTTTCCTGAACCACTA
                      ____________________________________________________________
consensus CCCCGAGCATGTAAGCCTCCGCTTAGAGCACATGCCAAACTACTCTTTCCTGAACCACTA
 
. : . : . : . : . : . :
JMFN003B15+ AGGCCAGTAATCCATATAACACAGCCTTTCTGCTGAAGCAACTCTTCCCTGTCAACCTTC
                      ____________________________________________________________
consensus AGGCCAGTAATCCATATAACACAGCCTTTCTGCTGAAGCAACTCTTCCCTGTCAACCTTC
 
. : . : . : . : . : . :
JMFN003B15+ TCAACTGTACATTTTTGCCAAACAATATTTGAAGAATTCCCAATAGTTGACAATTGAGGT
                      ____________________________________________________________
consensus TCAACTGTACATTTTTGCCAAACAATATTTGAAGAATTCCCAATAGTTGACAATTGAGGT
 
. : . : . : . : . : . :
JMFN003B15+ CTTTTTCCAGAGAAACCATCACATTCATTGATAAGAACCTCCTGCGAATCGCACCCAGAA
JMSF015I16+ ATCGCACCCAGAA
                      ____________________________________________________________
consensus CTTTTTCCAGAGAAACCATCACATTCATTGATAAGAACCTCCTGCGAATCGCACCCAGAA
 
. : . : . : . : . : . :
JMFN003B15+ TGATGAGATTTTTCGGCTCTGGGATTGACATTCGAGGTTCTAGAAGCTTCAAGAGTCCAA
JMSF015I16+ TGATGAGATTTTTCGGCTCTGGGATTGACATTCGAGGTTCTAGAAGCTTCAAGAGTCCAA
                      ____________________________________________________________
consensus TGATGAGATTTTTCGGCTCTGGGATTGACATTCGAGGTTCTAGAAGCTTCAAGAGTCCAA
 
. : . : . : . : . : . :
JMFN003B15+ ATAGGTCCAAGACAACTCGATTTCACCTCGCTGCCGATAATTCCGGATCGAAGGAATCCT
JMSF015I16+ ATAGGTCCAAGACAACTCGATTTCACCTCGCTGCCGATAATTCCGGATCGAAGGAATCCT
                      ____________________________________________________________
consensus ATAGGTCCAAGACAACTCGATTTCACCTCGCTGCCGATAATTCCGGATCGAAGGAATCCT
 
. : . : . : . : . : . :
JMFN003B15+ TCGCATCTACCAAGCCCTACAACCGGAAACTTCACAAACCCTACCTTTCCACACCTTGAT
JMSF015I16+ TCGCATCTACCAAGCCCTACAACCGGAAACTTCACAAACCCTACCTTTCCACACCTTGAT
JMSF001E13+ TACAACCGGAAACTTCACAAACCCTACCTTTCCACACCTTGAT
                      ____________________________________________________________
consensus TCGCATCTACCAAGCCCTACAACCGGAAACTTCACAAACCCTACCTTTCCACACCTTGAT
 
. : . : . : . : . : . :
JMFN003B15+ TCCGCAGAGTGAAGCCCCGGCAAGAATGAACAGCGAATCCAAGACTTGTGCCCTCCTATC
JMSF015I16+ TCCGCAGAGTGAAGCCCCGGCAAGAATGAACAGCGAATCCAAGACTTGTGCCCTCCTATC
JMSF001E13+ TCCGCAGAGTGAAGCCCCGGCAAGAATGAACAGCGAATCCAAGACTTGTGCCCTCCTATC
                      ____________________________________________________________
consensus TCCGCAGAGTGAAGCCCCGGCAAGAATGAACAGCGAATCCAAGACTTGTGCCCTCCTATC
 
. : . : . : . : . : . :
JMFN003B15+ GCAGTCGTCATCTCACAGGGATAATGGAACTATATGATTTGAAGGAA
JMSF015I16+ GCAGTCGTCATCTCACAGGGATAATGGAACTATATGATTTGAAGGAATGTAGACATACAC
JMSF001E13+ GCAGTCGTCATCTCACAGGGATAATGGAACTATATGATTTGAAGGAATGTAGACATACAC
                      ____________________________________________________________
consensus GCAGTCGTCATCTCACAGGGATAATGGAACTATATGATTTGAAGGAATGTAGACATACAC
 
. : . : . : . : . : . :
JMSF015I16+ ACATATACATACAAAAATTGGTAGCCAGAATGCATATGTCATCAGGTTATGGAAATGGAT
JMSF001E13+ ACATATACATACAAAAATTGGTAGCCAGAATGCATATGTCATCAGGTTATGGAAATGGAT
                      ____________________________________________________________
consensus ACATATACATACAAAAATTGGTAGCCAGAATGCATATGTCATCAGGTTATGGAAATGGAT
 
. : . : . : . : . : . :
JMSF015I16+ AATACAATCACGCATATACACACGCGAAGGCAATGGGATTTCCTGTAAGTGGTTTCTGAA
JMSF001E13+ AATACAATCACGCATATACACACGCGAAGGCAATGGGATTTCCTGTAAGTGGTTTCTGAA
                      ____________________________________________________________
consensus AATACAATCACGCATATACACACGCGAAGGCAATGGGATTTCCTGTAAGTGGTTTCTGAA
 
. : . : . : . : . : . :
JMSF015I16+ ACGGC
JMSF001E13+ ACGGCAGATGGAACACGACGGAACCTAATTCCATTTCATCCCACCATCTCTTCTCCTCGC
                      ____________________________________________________________
consensus ACGGCAGATGGAACACGACGGAACCTAATTCCATTTCATCCCACCATCTCTTCTCCTCGC