Previous Contig 004301:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF010M22Sequence549004301 (4)643008676 (5)gb:AP005245_18494553e-36Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN
JMSF001D20Sequence357004301 (4)772008676 (5)pir|T00937|T009372e-32hypothetical protein At2g42280 [imported] - Arabidopsis thaliana>gb:AC002561_153
JMSF006I18Sequence412004301 (4)121008676 (5)gb:OSJN00051_16939130.001Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K20, complete seque
JMSF014G20Sequence239004301 (4)705008676 (5)gb:AP005245_18494552e-32Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJN

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF010M22+ TCCGCCGCCA
                      ____________________________________________________________
consensus TCCGCCGCCA
 
. : . : . : . : . : . :
JMFF010M22+ TCTCCGGCTTCAGAAACTGCACAGAATTCTTCAGATCGCGCGAGTCGCAATTCAGGATGG
                      ____________________________________________________________
consensus TCTCCGGCTTCAGAAACTGCACAGAATTCTTCAGATCGCGCGAGTCGCAATTCAGGATGG
 
. : . : . : . : . : . :
JMFF010M22+ ACGAGAACATGGTCTCCGAGTCGGAGCTGGAGGAGCCGTCGTTCACCATGAAGCTGTCCG
                      ____________________________________________________________
consensus ACGAGAACATGGTCTCCGAGTCGGAGCTGGAGGAGCCGTCGTTCACCATGAAGCTGTCCG
 
. : . : . : . : . : . :
JMFF010M22+ CAGCGTCGTTCGCGGCGGCGGCGGCGGCGCTGTCCATGATGCCGGCGAAGAAGGAGCTCG
JMSF006I18+ TTCGCGGCGGCGGCGGCGGCGCTGTCCATGATGCCGGCGAAGAAGGAGCTCG
                      ____________________________________________________________
consensus CAGCGTCGTTCGCGGCGGCGGCGGCGGCGCTGTCCATGATGCCGGCGAAGAAGGAGCTCG
 
. : . : . : . : . : . :
JMFF010M22+ GAGCTGAGCGGTATCGCATCAGCCCGCCGCCGCTGCTGCTCTGCTGCTGATAAAGATCCG
JMSF006I18+ GAGCTGAGCGGTATCGCATCAGCCCGCCGCCGCTGCTGCTCTGCTGCTGATAAAGATCCG
JMSF001D20+ CTGAGCGGTATCGCATCAGCCCGCCGCCGCTGCTGCTCTGCTGCTGATAAAGATCCG
                      ____________________________________________________________
consensus GAGCTGAGCGGTATCGCATCAGCCCGCCGCCGCTGCTGCTCTGCTGCTGATAAAGATCCG
 
. : . : . : . : . : . :
JMFF010M22+ AACCCATCACTTCTTTGCTCTTCAGGAACTCATTACTCTGCATATCATTCTTGTAACCGG
JMSF006I18+ AACCCATCACTTCTTTGCTCTTCAGGAACTCATTACTCTGCATATCATTCTTGTAACCGG
JMSF001D20+ AACCCATCACTTCTTTGCTCTTCAGGAACTCATTACTCTGCATATCATTCTTGTAACCGG
                      ____________________________________________________________
consensus AACCCATCACTTCTTTGCTCTTCAGGAACTCATTACTCTGCATATCATTCTTGTAACCGG
 
. : . : . : . : . : . :
JMFF010M22+ AATTAGCAGGCGGGAACAAGAAGCTGCTGGCGCTCCCACCGGTCAACTCTCTGGAAATCG
JMSF014G20+ ATTAGCAGGCGGGAACAAGAAGCTGCTGGCGCTCCCACCGGTCAACTCTCTGGAAATCG
JMSF006I18+ AATTAGCAGGCGGGAACAAGAAGCTGCTGGCGCTCCCACCGGTCAACTCTCTGGAAATCG
JMSF001D20+ AATTAGCAGGCGGGAACAAGAAGCTGCTGGCGCTCCCACCGGTCAACTCTCTGGAAATCG
                      ____________________________________________________________
consensus AATTAGCAGGCGGGAACAAGAAGCTGCTGGCGCTCCCACCGGTCAACTCTCTGGAAATCG
 
. : . : . : . : . : . :
JMFF010M22+ GAGCTTCTGAGCTAAACATGGGCGCAGTTTTTTCAAGAATCGTGGAAGAAATCTGAGGAA
JMSF014G20+ GAGCTTCTGAGCTAAACATGGGCGCAGTTTTTTCAAGAATCGTGGAAGAAATCTGAGGAA
JMSF006I18+ GAGCTTCTGAGCTAAACATGGGCGCAGTTTTTTCAAGAATCGTGGAAGAAATCTGAGGAA
JMSF001D20+ GAGCTTCTGAGCTAAACATGGGCGCAGTTTTTTCAAGAATCGTGGAAGAAATCTGAGGAA
                      ____________________________________________________________
consensus GAGCTTCTGAGCTAAACATGGGCGCAGTTTTTTCAAGAATCGTGGAAGAAATCTGAGGAA
 
. : . : . : . : . : . :
JMFF010M22+ AGGGGGAGAGGATTTATGGGTCTGAACCAAAAACGATACAAGGTTATGGAATTGGCTCAA
JMSF014G20+ AGGGGGAGAGGATTTATGGGTCTGAACCAAAAACGATACAAGGTTATGGAATTGGCTCAA
JMSF006I18+ AGGGGGAGAGGATTTATGGGTCTGAACCAAAAACGATACAAGGTTATGGAATTGGCTCAA
JMSF001D20+ AGGGGGAGAGGATTTATGGGTCTGAACCAAAAACGATACAAGGTTATGGAATTGGCTCAA
                      ____________________________________________________________
consensus AGGGGGAGAGGATTTATGGGTCTGAACCAAAAACGATACAAGGTTATGGAATTGGCTCAA
 
. : . : . : . : . : . :
JMFF010M22+ ATCCGCATAGATTTCTGGGAAGAAAAACCAGGAATGGCATGTGAGACAGAAAGCGAT
JMSF014G20+ ATCCGCATAGATTTCTGGGAAGAAAAACCAGGAATGGCATGTGAGACAGAAAGCGAT
JMSF006I18+ ATCCGCATAGATTTCTGGGAAGAAAAACCAGGAATGGCATGTGAGACAGAAAGCGAT
JMSF001D20+ ATCCGCATAGATTTCTGGGAAGAAAAACCAGGAATGGCATGTGAGACAGAAAGCGATTTC
                      ____________________________________________________________
consensus ATCCGCATAGATTTCTGGGAAGAAAAACCAGGAATGGCATGTGAGACAGAAAGCGATTTC