Previous Contig 004297:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017O09Sequence548004297 (5)gb:AX028838_14571804e-26Sequence 22 from Patent WO9732023.758010314 (4)gb:AB122079_15280343e-64Panax ginseng mRNA for cytochrome P450, complete cds.
JMFF043H18Sequence647004297 (5)gb:AB122079_15280343e-33Panax ginseng mRNA for cytochrome P450, complete cds.615010314 (4)gb:AB122079_15280348e-51Panax ginseng mRNA for cytochrome P450, complete cds.
JMSF001D10Sequence313004297 (5)733010314 (4)gb:AB122079_15280343e-64Panax ginseng mRNA for cytochrome P450, complete cds.
JMSF002H14Sequence430004297 (5)gb:AX028838_14571808e-14Sequence 22 from Patent WO9732023.
JMSF019D01Sequence437004297 (5)gb:AX028838_14571802e-14Sequence 22 from Patent WO9732023.775010314 (4)gb:AB122079_15280342e-66Panax ginseng mRNA for cytochrome P450, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF043H18+ TCATGTCCATGCTCATGAAGAAATGGTGTACTCAAATCAACAGCTTGCCGT
                      ____________________________________________________________
consensus TCATGTCCATGCTCATGAAGAAATGGTGTACTCAAATCAACAGCTTGCCGT
 
. : . : . : . : . : . :
JMFF043H18+ TTCTGGGCTGCCTGCTTGAAGGAATCTACGACAAGACCCAACTCTTCTCTTCTCATAGAT
JMFF017O09+ CTTCTCATAGAT
                      ____________________________________________________________
consensus TTCTGGGCTGCCTGCTTGAAGGAATCTACGACAAGACCCAACTCTTCTCTTCTCATAGAT
 
. : . : . : . : . : . :
JMFF043H18+ TGAAAAGAATTGATCTTGAGATTGCTGAGGAGCTCTAAGGTGCAGAGCTTTCGCATGTTG
JMFF017O09+ TGAAAAGAATTGATCTTGAGATTGCTGAGGAGCTCTAAGGTGCAGAGCTTTCGCATGTTG
                      ____________________________________________________________
consensus TGAAAAGAATTGATCTTGAGATTGCTGAGGAGCTCTAAGGTGCAGAGCTTTCGCATGTTG
 
. : . : . : . : . : . :
JMFF043H18+ CGCCAAAACGGACCGTATGGCCCGAACGCCAAATCCCTTTGCTCATAGGCTATATAGTTG
JMFF017O09+ CGCCAAAACGGACCGTATGGCCCGAACGCCAAATCCCTTTGCTCATAGGCTATATAGTTG
JMSF002H14+ CATAGGCTATGTAGTTG
JMSF019D01+ CATAGGCTATATAGTTG
                      ____________________________________________________________
consensus CGCCAAAACGGACCGTATGGCCCGAACGCCAAATCCCTTTGCTCATAGGCTATATAGTTG
 
. : . : . : . : . : . :
JMFF043H18+ GCAGCTTGGTTTGGTGGCCGGCTGGCGAAATTGAGGTCGTGTGTCTTCAGAAACCGCTCG
JMFF017O09+ GCAGCTTGGTTTGGTGGCCGGCTGGCGAAATTGAGGTCGTGTGTCTTCAGAAACCGCTCG
JMSF002H14+ GCAGCTTGGTTTGGTGGCCGGCTGGCGAAATTGAGGTCGTGTGTCTTGAGAAACCGCTCG
JMSF019D01+ GCAGCTTGGTTTGGTGGCCGGCTGGCGAAATTGAGGTCGTGTGTCTTCAGAAACCGCTCG
                      ____________________________________________________________
consensus GCAGCTTGGTTTGGTGGCCGGCTGGCGAAATTGAGGTCGTGTGTCTTCAGAAACCGCTCG
 
. : . : . : . : . : . :
JMFF043H18+ GCCGCTTGAGGTGATGATACGATGATGTTGTCGGTCAGCCCTAGTCGTAGGTACATCATA
JMFF017O09+ GCCGCTTGAGGTGATGATACGATGATGTTGTCGGTCAGCCCTAGTCGTAGGTACATCATA
JMSF002H14+ GCCGCTTGAGGTGATGGTACGATGATGTTGTCGGTCAGCCCTAGTCGTAGGTACATCATA
JMSF019D01+ GCCGCTTGAGGTGATGATACGATGATGTTGTCGGTCAGCCCTAGTCGTAGGTACATCATA
JMSF001D10+ CGTAGGTACATCATA
                      ____________________________________________________________
consensus GCCGCTTGAGGTGATGATACGATGATGTTGTCGGTCAGCCCTAGTCGTAGGTACATCATA
 
. : . : . : . : . : . :
JMFF043H18+ GGACCGTAGGTTTTGGAGAGTTTTTGCATATCTTGGTGGGGGTTCTTCCCCAGCAAATGG
JMFF017O09+ GGACCGTAGGTTTTGGAGAGTTTTTGCATATCTTGGTGGGGGTTCTTCCCCAGCAAATGG
JMSF002H14+ GGACCGTAGGTTTTGGAGAGTTTTTGCATATCTTGGTGGGGGTTTTTCCCCAGCAAATGG
JMSF019D01+ GGACCGTAGGTTTTGGAGAGTTTTTGCATATCTTGGTGGGGGTTCTTCCCCAGCAAATGG
JMSF001D10+ GGACCGTAGGTTTTGGAGAGTTTTTGCATATCTTGGTGGGGGTTCTTCCCCAGCAAATGG
                      ____________________________________________________________
consensus GGACCGTAGGTTTTGGAGAGTTTTTGCATATCTTGGTGGGGGTTCTTCCCCAGCAAATGG
 
. : . : . : . : . : . :
JMFF043H18+ AGATGTCCCAATATTGGCAGCCCTTTGGGACCTGGTGGCAACCTTTTCCTTTTGTTGTTC
JMFF017O09+ AGATGTCCCAATATTGGCAGCCCTTTGGGACCTGATGGCAACCTTTTCCTTTTGTTGTTC
JMSF002H14+ AGGTGTCCCAATATTGGAAGCCCTTTGGGACCTGGTGGCAACCTTTTCCTTTTGTTGTTC
JMSF019D01+ AGATGTCCCAATATTGGCAGCCCTTTGGGACCTGGTGGCAACCTTTTCCTTTTGTTGTTC
JMSF001D10+ AGATGTCCCAATATTGGCAGCCCTTTGGGACCTGGTGGCAACCTTTTCCTTTTGTTGTTC
                      ____________________________________________________________
consensus AGATGTCCCAATATTGGCAGCCCTTTGGGACCTGGTGGCAACCTTTTCCTTTTGTTGTTC
 
. : . : . : . : . : . :
JMFF043H18+ CTAAATAATAACTCGTACACAGCAATGGCTGCAGCCAGCACTGCTGCAAAGCCTGCCCAA
JMFF017O09+ CTAAATAATAACTCGTACACAGCAATGGCTGCAGCCAGCACTGCTGCAAAGCCTGCCCAA
JMSF002H14+ GTA---AATGCCTCGTACACAACAATGGCT---GCCACCACTGCTGCAAAGCCTGCCCAA
JMSF019D01+ CTAAATAATAACTCGTACACAGCAATGGCTGCAGCCAGCACTGCTGCAAAGCCTGCCCAA
JMSF001D10+ CTAAATAATAACTCGTACACAGCAATGGCTGCAGCCAGCACTGCTGCAAAGCCTGCCCAA
                      ____________________________________________________________
consensus CTAAATAATAACTCGTACACAGCAATGGCTGCAGCCAGCACTGCTGCAAAGCCTGCCCAA
 
. : . : . : . : . : . :
JMFF043H18+ ATCCAGGCCGTAGTGTTCATCATCATGGTTTTAAT-TTGGTTTCTTGACAGAGACGATAT
JMFF017O09+ ATCCAGGCCGTAGTGTTCATCATCATGGTTTTAAT-TTGGTTTCTTGACAGAGACGATAT
JMSF002H14+ ATCCAGGCGGCCGTGTTCATCATCATCATTGTTTTGATGGTTTCTTGACACAGACGATAT
JMSF019D01+ ATCCAGGCCGTAGTGTTCATCATCATGGTTTTAAT-TTGGTTTCTTGACAGAGACGATAT
JMSF001D10+ ATCCAGGCCGTAGTGTTCATCATCATGGTTTTAAT-TTGGTTTCTTGACAGAGACGATAT
                      ____________________________________________________________
consensus ATCCAGGCCGTAGTGTTCATCATCATGGTTTTAAT-TTGGTTTCTTGACAGAGACGATAT
 
. : . : . : . : . : . :
JMFF043H18+ GAT-GATGAACACAAATTTGATTGCTTGATTGGTTAATGATGTTTTTGTTGTTGTGTT
JMFF017O09+ GAT-GATGAACACAAATTTGATTGCTTGATTGGTTAATGATGGTTTTGTTGTTGTGTT
JMSF002H14+ GATCGACGAACACAGGTTTGATTGGTGAATTGGTTAATGATGTTTTTGTTGTTGTGTT
JMSF019D01+ GAT-GATGAACACAAATTTGATTGCTTGATTGGTTAATGATGTTTTTGTTGTTGTGTT
JMSF001D10+ GAT-GATGAACACAAATTTGATTGCTTGATTGGTTAATGATGTTTTTGTTGTTGTGTTCC
                      ____________________________________________________________
consensus GAT-GATGAACACAAATTTGATTGCTTGATTGGTTAATGATGTTTTTGTTGTTGTGTTCC