Previous Contig 004286:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001B23Sequence225004286 (3)291001449 (19)gb:AJ843122_18145072e-20Plantago major mRNA for vacuolar H+-ATPase C subunit (vatpc1 gene).
JMSF039E22Sequence596004286 (3)gb:AB026649_15172293e-39Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MOJ10.>gb:AY045950_156572004286 (3)gb:AB026649_15172293e-39Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MOJ10.>gb:AY045950_156

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039E22+ ACGGCAACTAACTACACACG
                      ____________________________________________________________
consensus ACGGCAACTAACTACACACG
 
. : . : . : . : . : . :
rJMSF039E22- GTTGGTTGGTACAGAATGGTGTAGGTCATATATATATATATATATAAGAATATCT
JMSF039E22+ TTTATGTTGGTTGGTACAGAAT-GTGTAGGTCATATATATATATATATATAAGAATATCT
                      ____________________________________________________________
consensus TTTATGTTGGTTGGTACAGAATGGTGTAGGTCATATATATATATATATATAAGAATATCT
 
. : . : . : . : . : . :
rJMSF039E22- CCATCCATGAGGTATAATACTGTTTACAGATTATTGTTTGTTTGAGGAATACTTGATTCA
JMSF039E22+ CCATCCATGAGGTATAATACTGTTTACAGATTATTGTTTGTTTGAGGAATACTTGATTCA
                      ____________________________________________________________
consensus CCATCCATGAGGTATAATACTGTTTACAGATTATTGTTTGTTTGAGGAATACTTGATTCA
 
. : . : . : . : . : . :
rJMSF039E22- CAATCCCCACACCAACAAATCTCATTCACAATATGGAGCACGAACACATGTTTTTCTTTG
JMSF039E22+ CAATCCCCACACCAACAAATCTCATTCACAATATGGAGCACGAACACATGTTTTTCTTTG
                      ____________________________________________________________
consensus CAATCCCCACACCAACAAATCTCATTCACAATATGGAGCACGAACACATGTTTTTCTTTG
 
. : . : . : . : . : . :
rJMSF039E22- GAGCCTCCTCGATCTTCTTTTCTGATTTTGCTTTAGCTACAGATGGCTGTACAACAGCAT
JMSF039E22+ GAGCCTCCTCGATCTTCTTTTCTGATTTTGCTTTAGCTACAGATGGCTGTACAACAGCAT
                      ____________________________________________________________
consensus GAGCCTCCTCGATCTTCTTTTCTGATTTTGCTTTAGCTACAGATGGCTGTACAACAGCAT
 
. : . : . : . : . : . :
rJMSF039E22- GCATGGTAATTACACCTTTAGGTAGCTCTCCAAAAGGCATCTTGCACTGACCAACAGTCT
JMSF039E22+ GCATGGTAATTACACCTTTAGGTAGCTCTCCAAAAGGCATCTTGCACTGACCAACAGTCT
                      ____________________________________________________________
consensus GCATGGTAATTACACCTTTAGGTAGCTCTCCAAAAGGCATCTTGCACTGACCAACAGTCT
 
. : . : . : . : . : . :
rJMSF039E22- TGCTGTTTTCTAAAATTTTCCCAGCGCTGATCAATTTTACATCATTTGCTGCCTTGGGTG
JMSF039E22+ TGCTGTTTTCTAAAATTTTCCCAGCGCTGATCAATTTTACATCATTTGCTGCCTTGGGTG
                      ____________________________________________________________
consensus TGCTGTTTTCTAAAATTTTCCCAGCGCTGATCAATTTTACATCATTTGCTGCCTTGGGTG
 
. : . : . : . : . : . :
rJMSF039E22- CAATTTTTTTATCTTTAGGCCATTCGGCAACGATTCTCTCCTTTAGCATAGCTACAGTAG
JMSF039E22+ CAATTTTTTTATCTTTAGGCCATTCGGCAACGATTCTCTCCTTTAGCATAGCTACAGTAG
                      ____________________________________________________________
consensus CAATTTTTTTATCTTTAGGCCATTCGGCAACGATTCTCTCCTTTAGCATAGCTACAGTAG
 
. : . : . : . : . : . :
rJMSF039E22- AAGCGGGGGAATACCGAAACGGACCAATATCCGATCCATCGTACAACCGGAACTTGAGCT
JMSF039E22+ AAGCGGGGGAATACCGAAACGGACCAATATCCGATCCATCGTACAACCGGAACTTGAGCT
                      ____________________________________________________________
consensus AAGCGGGGGAATACCGAAACGGACCAATATCCGATCCATCGTACAACCGGAACTTGAGCT
 
. : . : . : . : . : . :
rJMSF039E22- CTACCAAATCCTCCTCCGGCATTTGCAATCGGAAACCGTCTCCTCCTCAATCGCCCTTCC
JMSF039E22+ CTACCAAATCCTCCTCCGGCATTTGCAATCGGAAACCGTCTCCTCCTCAATCGCCCTTCC
JMSF001B23+ CCGGCATTTGCAATCGGAAACCGTCTCCTCCTCAATCGCCCTTCC
                      ____________________________________________________________
consensus CTACCAAATCCTCCTCCGGCATTTGCAATCGGAAACCGTCTCCTCCTCAATCGCCCTTCC
 
. : . : . : . : . : . :
rJMSF039E22- GCTCCCGACACC
JMSF039E22+ GCTCCCGACACC
JMSF001B23+ GCTCCCGACACCAGTGGATTTAAAAAAAGGAGATGACTATGATGATACACCAGATTTGAT
                      ____________________________________________________________
consensus GCTCCCGACACCAGTGGATTTAAAAAAAGGAGATGACTATGATGATACACCAGATTTGAT
 
. : . : . : . : . : . :
JMSF001B23+ ACGTTTTTGCTAATCGTGGAAGTTTGATTAAACTAATGCGAAAAGAGATGAGGCGAATCA
                      ____________________________________________________________
consensus ACGTTTTTGCTAATCGTGGAAGTTTGATTAAACTAATGCGAAAAGAGATGAGGCGAATCA
 
. : . : . : . : . : . :
JMSF001B23+ GTTTTCCAGCACTACTCGCAGTAAAGAAAACCCTAAGGACCCGATATTCACGCTCACTCA
                      ____________________________________________________________
consensus GTTTTCCAGCACTACTCGCAGTAAAGAAAACCCTAAGGACCCGATATTCACGCTCACTCA