Previous Contig 004283:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001B13Sequence228004283 (3)pir|F84845|F848451e-06hypothetical protein At2g41750 [imported] - Arabidopsis thaliana>gb:AC002339_153752021960pir|F84845|F848452e-47hypothetical protein At2g41750 [imported] - Arabidopsis thaliana>gb:AC002339_153
JMSF015A13Sequence491004283 (3)pir|F84845|F848452e-13hypothetical protein At2g41750 [imported] - Arabidopsis thaliana>gb:AC002339_153768004283 (3)pir|F84845|F848450.001hypothetical protein At2g41750 [imported] - Arabidopsis thaliana>gb:AC002339_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF015A13- TA
                      ____________________________________________________________
consensus TA
 
. : . : . : . : . : . :
rJMSF015A13- ACAGAGACCTGAACCAAATGGTCAAGACTTAAGTTTGCCACCTGCACTGATTTATCAATT
                      ____________________________________________________________
consensus ACAGAGACCTGAACCAAATGGTCAAGACTTAAGTTTGCCACCTGCACTGATTTATCAATT
 
. : . : . : . : . : . :
rJMSF015A13- TTAAAGCTAGGCCCTACCACACAAAATCAACTATAATGTTACTTAAAGGTCCAATCTTCT
                      ____________________________________________________________
consensus TTAAAGCTAGGCCCTACCACACAAAATCAACTATAATGTTACTTAAAGGTCCAATCTTCT
 
. : . : . : . : . : . :
rJMSF015A13- TACTCTTCTTCACTTCCACTTCACCCTTTTTATCAAAAGCTTAAGCCATGATTCAAACAC
                      ____________________________________________________________
consensus TACTCTTCTTCACTTCCACTTCACCCTTTTTATCAAAAGCTTAAGCCATGATTCAAACAC
 
. : . : . : . : . : . :
rJMSF015A13- ATAGAGAGTAGAGATATCTCACAACTTTGACAAAGTCCCGCTAAACCTGGTCTGGTGGCC
                      ____________________________________________________________
consensus ATAGAGAGTAGAGATATCTCACAACTTTGACAAAGTCCCGCTAAACCTGGTCTGGTGGCC
 
. : . : . : . : . : . :
rJMSF015A13- CTGTAATGTGATTTAGCAACCTCTCTGATACATCCTCTGAATGTGGATACTTTGCAACTG
                      ____________________________________________________________
consensus CTGTAATGTGATTTAGCAACCTCTCTGATACATCCTCTGAATGTGGATACTTTGCAACTG
 
. : . : . : . : . : . :
rJMSF015A13- TATCTGAATTCAAGGCTATGTCTGTGAATTTCCTAAAAGCAAAGCAAAGCAAACCGGGCG
                      ____________________________________________________________
consensus TATCTGAATTCAAGGCTATGTCTGTGAATTTCCTAAAAGCAAAGCAAAGCAAACCGGGCG
 
. : . : . : . : . : . :
rJMSF015A13- GCAAGTTTGGCAAATATGTGCATTTAACTTGACAGGATTACAAGTCCAACCAACACCAAT
                      ____________________________________________________________
consensus GCAAGTTTGGCAAATATGTGCATTTAACTTGACAGGATTACAAGTCCAACCAACACCAAT
 
. : . : . : . : . : . :
rJMSF015A13- CAAACTCTGGTATCTTCATTCACATGAAGGCAATGAAACCAACTTGGTTCATTTCAATAA
                      ____________________________________________________________
consensus CAAACTCTGGTATCTTCATTCACATGAAGGCAATGAAACCAACTTGGTTCATTTCAATAA
 
. : . : . : . : . : . :
rJMSF015A13- ATGTGACTTGTGAACAAACAAAAGTTCTGGCTTGTTGGAATTAGTCCAGATTGAATGGCT
                      ____________________________________________________________
consensus ATGTGACTTGTGAACAAACAAAAGTTCTGGCTTGTTGGAATTAGTCCAGATTGAATGGCT
 
. : . : . : . : . : . :
rJMSF015A13- GATATGCTTGATAACTCTGAAAATCAGGAAAGAGAAAAACAGCTCTGCGGGGCACATTAG
JMSF015A13+ CAGGAAAGAGAAAAACAGCTCTGCGGGGCACATTAG
                      ____________________________________________________________
consensus GATATGCTTGATAACTCTGAAAATCAGGAAAGAGAAAAACAGCTCTGCGGGGCACATTAG
 
. : . : . : . : . : . :
rJMSF015A13- GGTTTGCAACTGCCTCATCATGAAGATTATCGAGGACCTTTGAATCACCATAACGAAGTC
JMSF015A13+ GGTTTGCAACTGCCTCATCATGAAGATTATCGAGGACCTTTGAATCACCATAACGAAGTC
                      ____________________________________________________________
consensus GGTTTGCAACTGCCTCATCATGAAGATTATCGAGGACCTTTGAATCACCATAACGAAGTC
 
. : . : . : . : . : . :
rJMSF015A13- TCCGTCCGGCAATGACCTCGCAATTTCCCAAGCACTTGGACAGAACAGGAACAGTGGCGA
JMSF015A13+ TCCGTCCGGCAATGACCTCGCAATTTCCCAAGCACTTGGACAGAACAGGAACAGTGGCGA
                      ____________________________________________________________
consensus TCCGTCCGGCAATGACCTCGCAATTTCCCAAGCACTTGGACAGAACAGGAACAGTGGCGA
 
. : . : . : . : . : . :
rJMSF015A13- GCTTGTGGCGGCGCTCGTGAGGGTGCTGGAGGACAACGACTCGGGT
JMSF015A13+ GCTTGTGGCGGCGCTCGTGAGGGTGCTGGAGGACAACGACTCGGGTCAGGTTCGAAATCG
JMSF001B13+ GCTCGTGAGGGTGCTGGAGGACAACGACTCGGGTCAGGTTCGAAATCG
                      ____________________________________________________________
consensus GCTTGTGGCGGCGCTCGTGAGGGTGCTGGAGGACAACGACTCGGGTCAGGTTCGAAATCG
 
. : . : . : . : . : . :
JMSF015A13+ GGTCGGGTGGGATTGTAGCGCATAAGCAAACGTTTGCTGGCCTGTCGCATTTGGCGCATA
JMSF001B13+ GGTCGGGTGGGATTGTAGCGCATAAGCAAACGTTTGCTGGCCTGTCGCATTTGGCGCATA
                      ____________________________________________________________
consensus GGTCGGGTGGGATTGTAGCGCATAAGCAAACGTTTGCTGGCCTGTCGCATTTGGCGCATA
 
. : . : . : . : . : . :
JMSF015A13+ TCCTTCGTCTTGTTTGGAAGTCGCCGGCGGCGTCAGGGATGTCTTTGTCAGCTGCGCAAT
JMSF001B13+ TCCTTCGTCTTGTTTGGAAGTCGCCGGCGGCGTCAGGGATGTCTTTGTCAGCTGCGCAAT
                      ____________________________________________________________
consensus TCCTTCGTCTTGTTTGGAAGTCGCCGGCGGCGTCAGGGATGTCTTTGTCAGCTGCGCAAT
 
. : . : . : . : . : . :
JMSF015A13+ TTTCCGGCGCCATTCCAGTGTTTGAGAATGTTG
JMSF001B13+ TTTCCGGCGCCATTCCAGTGTTTGAGAATGTTGCCGCCGAGGGAGGGAAATGCTTCTCTC
                      ____________________________________________________________
consensus TTTCCGGCGCCATTCCAGTGTTTGAGAATGTTGCCGCCGAGGGAGGGAAATGCTTCTCTC