Previous Contig 004280:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMSF001A13Sequence158004280 (6)
JMSF004L12Sequence384004280 (6)gb:AY087538_15725683e-08Arabidopsis thaliana clone 36448 mRNA, complete sequence.
JMSF044I09Sequence760004280 (6)gb:AY087538_15725681e-24Arabidopsis thaliana clone 36448 mRNA, complete sequence.674004280 (6)gb:AY087538_15725685e-05Arabidopsis thaliana clone 36448 mRNA, complete sequence.
JMSF044I10Sequence790004280 (6)gb:AY087538_15725683e-21Arabidopsis thaliana clone 36448 mRNA, complete sequence.762004280 (6)gb:AY087538_15725686e-05Arabidopsis thaliana clone 36448 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF044I09- TAGCATTCATTCATTTACAGAGAACAAAAGTAACTATAGAGCGAGTCAAATTTTA
rJMSF044I10- AGCATTCATTCATTTACAGAGAACAAAAGTAACTATAGAGCGAGTCAAATTTTA
                      ____________________________________________________________
consensus TAGCATTCATTCATTTACAGAGAACAAAAGTAACTATAGAGCGAGTCAAATTTTA
 
. : . : . : . : . : . :
rJMSF044I09- ACATTTTTCACCTTGGAAATAAATGTACATGTTCCTTCCTCCAATCTTCTTCTTCTTCTA
rJMSF044I10- ACATTTTTCACCTTGGAAATAAATGTACATGTTCCTTCCTCCAATCTTCTTCTTCTTCTA
                      ____________________________________________________________
consensus ACATTTTTCACCTTGGAAATAAATGTACATGTTCCTTCCTCCAATCTTCTTCTTCTTCTA
 
. : . : . : . : . : . :
rJMSF044I09- CCACTACTTTTACTGTAGTATATTTCAACAAATTAAACCCTAAAAATCTTACCTTTTCTT
rJMSF044I10- CCACTACTTTTACTGTAGTATATTTCAACAAATTAAACCCTAAAAATCTTACCTTTTCTT
                      ____________________________________________________________
consensus CCACTACTTTTACTGTAGTATATTTCAACAAATTAAACCCTAAAAATCTTACCTTTTCTT
 
. : . : . : . : . : . :
rJMSF044I09- TGTATTGGACTGGAATTCTTCAAATACCTTTCCAGGTTGGGCTAGAAACAGGAACCGTCG
rJMSF044I10- TGTATTGGACTGGAATTCTTCAAATACCTTTCCAGGTTGGGCTAGAAACAGGAACCGTCG
                      ____________________________________________________________
consensus TGTATTGGACTGGAATTCTTCAAATACCTTTCCAGGTTGGGCTAGAAACAGGAACCGTCG
 
. : . : . : . : . : . :
rJMSF044I09- GAGACAGGGGGAGCTGCGGGAACCCTAGTTGACCCGCCGGTGAAAACAGCAGATTTGGTG
rJMSF044I10- GAGACAGGGGGAGCTGCGGGAACCCTAGTTGACCCGCCGGTGAAAACAGCAGATTTGGTG
                      ____________________________________________________________
consensus GAGACAGGGGGAGCTGCGGGAACCCTAGTTGACCCGCCGGTGAAAACAGCAGATTTGGTG
 
. : . : . : . : . : . :
rJMSF044I09- ACAGCAAGGCGCAGGGAGACCTCGGCGACGGCGACGGCAGGCAGCTAAAGGGCAGTGGAG
rJMSF044I10- ACAGCAAGGCGCAGGGAGACCTCGGCGACGGCGACGGCAGGCAGCTAAAGGGCAGTGGAG
                      ____________________________________________________________
consensus ACAGCAAGGCGCAGGGAGACCTCGGCGACGGCGACGGCAGGCAGCTAAAGGGCAGTGGAG
 
. : . : . : . : . : . :
rJMSF044I09- AAGACGGCATAGCAGGAAATTGCGGTAAGATTGCGGCGGATGATGGCTGAGGTGGTGGCG
rJMSF044I10- AAGACGGCATAGCAGGAAATTGCGGTAAGATTGCGGCGGATGATGGCTGAGGTGGTGGCG
JMSF044I10+ AGATTGCGGCGGATGATGGCTGAGGTGGTGGCG
JMSF044I09+ GCG
                      ____________________________________________________________
consensus AAGACGGCATAGCAGGAAATTGCGGTAAGATTGCGGCGGATGATGGCTGAGGTGGTGGCG
 
. : . : . : . : . : . :
rJMSF044I09- GAGGAGGAGGAAGAGGAGGAGCGAAGGTGTTCCATCGCGGCGAAGCAAGCGGGGCGAGCG
rJMSF044I10- GAGGAGGAGGAAGAGGAGGAGCGAAGGTGTTCCATCGCGGCGAAGCAAGCGGGGCGAGCG
JMSF044I10+ GAGGAGGAGGAAGAGGAGGAGCGAAGGTGTTCCATCGCGGCGAAGCAAGCGGGGCGAGCG
JMSF044I09+ GAGGAGGAGGAAGAGGAGGAGCGAAGGTGTTCCATCGCGGCGAAGCAAGCGGGGCGAGCG
                      ____________________________________________________________
consensus GAGGAGGAGGAAGAGGAGGAGCGAAGGTGTTCCATCGCGGCGAAGCAAGCGGGGCGAGCG
 
. : . : . : . : . : . :
rJMSF044I09- GGGGAAGCCCGGTGGAGAAGCGCTTGGAATCGGAGTCAGCGGCGGTGGCGGCGAAAGAGG
rJMSF044I10- GGGGAAGCCCGGTGGAGAAGCGCTTGGAATCGGAGTCAGCGGCGGTGGCGGCGAAAGAGG
JMSF044I10+ GGGGAAGCCCGGTGGAGAAGCGCTTGGAATCGGAGTCAGCGGCGGTGGCGGCGAAAGAGG
JMSF044I09+ GGGGAAGCCCGGTGGAGAAGCGCTTGGAATCGGAGTCAGCGGCGGTGGCGGCGAAAGAGG
                      ____________________________________________________________
consensus GGGGAAGCCCGGTGGAGAAGCGCTTGGAATCGGAGTCAGCGGCGGTGGCGGCGAAAGAGG
 
. : . : . : . : . : . :
rJMSF044I09- TGTGGAGGAACCTCATGTACGCGGAGATCGGCGACTCGGCCGCCGCGTGTACGGCGGGAA
rJMSF044I10- TGTGGAGGAACCTCATGTACGCGGAGATCGGCGACTCGGCCGCCGCGTGTACGGCGGGAA
JMSF044I10+ TGTGGAGGAACCTCATGTACGCGGAGATCGGCGACTCGGCCGCCGCGTGTACGGCGGGAA
JMSF044I09+ TGTGGAGGAACCTCATGTACGCGGAGATCGGCGACTCGGCCGCCGCGTGTACGGCGGGAA
                      ____________________________________________________________
consensus TGTGGAGGAACCTCATGTACGCGGAGATCGGCGACTCGGCCGCCGCGTGTACGGCGGGAA
 
. : . : . : . : . : . :
rJMSF044I09- ACGGCGGAAGAGGGGAAAGAGGCTGGGGTTGAGGAGGGCGTAGTCCAACGCCGACGAACC
rJMSF044I10- ACGGCGGAAGAGGGGAAAGAGGCTGGGGTTGAGGAGGGCGTAGTCCAACGCCGACGAACC
JMSF044I10+ ACGGCGGAAGAGGGGAAAGAGGCTGGGGTTGAGGAGGGCGTAGTCCAACGCCGACGAACC
JMSF044I09+ ACGGCGGAAGAGGGGAAAGAGGCTGGGGTTGAGGAGGGCGTAGTCCAACGCCGACGAACC
                      ____________________________________________________________
consensus ACGGCGGAAGAGGGGAAAGAGGCTGGGGTTGAGGAGGGCGTAGTCCAACGCCGACGAACC
 
. : . : . : . : . : . :
rJMSF044I09- CTCCGCCGCCGCCCGGAAG
rJMSF044I10- CTCCGCCGCCGCCCGGAAGCAGGAGCGGAGGGCCGGCGACGGTCAACAGCGGAGATGGGG
JMSF044I10+ CTCCGCCGCCGCCCGGAAGCAGGAGCGGAGGGCCGGCGACGGTCAACAGCGGAGAT-GGG
JMSF044I09+ CTCCGCCGCCGCCCGGAAGCAGGAGCGGAGGGCCGGCGACGGTCAACAGCGGAGAT-GGG
                      ____________________________________________________________
consensus CTCCGCCGCCGCCCGGAAGCAGGAGCGGAGGGCCGGCGACGGTCAACAGCGGAGAT-GGG
 
. : . : . : . : . : . :
rJMSF044I10- CGGTTGCCTATTTGCACCAGCGNCGGAGGGCGAATCCTCTGCAACCTC
JMSF044I10+ CGGTTGCCTATTTGCACCAGCGGCGGAGGGCGAATCCTCTGCAACCTCGAACTGGGCGGC
JMSF044I09+ CGGTTGCCTATTTGCACCAGCGGCGGAGGGCGAATCCTCTGCAACCTCGAACTGGGCGGC
                      ____________________________________________________________
consensus CGGTTGCCTATTTGCACCAGCGGCGGAGGGCGAATCCTCTGCAACCTCGAACTGGGCGGC
 
. : . : . : . : . : . :
JMSF044I10+ TTGGGCTGGTGAATCGGCGGCGGAGTCGACATCCGCTCGTGCGCCGGAGATCCGGTGAGC
JMSF004L12+ CATCCGCTCGTGCGCCGGAGATCCGGTGAGC
JMSF044I09+ TTGGGCTGGTGAATCGGCGGCGGAGTCGACATCCGCTCGTGCGCCGGAGATCCGGTGAGC
                      ____________________________________________________________
consensus TTGGGCTGGTGAATCGGCGGCGGAGTCGACATCCGCTCGTGCGCCGGAGATCCGGTGAGC
 
. : . : . : . : . : . :
JMSF044I10+ TTCTGAACCACGTCGCGAAAATCACTCTTGTTTATGTTATAAACCGGCGGCTGCTGCTGC
JMSF004L12+ TTCTGAACCACGTCGCGAAAATCACTCTTGTTTATGTTATAAACCGGCGGCTGCTGCTGC
JMSF044I09+ TTCTGAACCACGTCGCGAAAATCACTCTTGTTTATGTTATAAACCGGCGGCTGCTGCTGC
                      ____________________________________________________________
consensus TTCTGAACCACGTCGCGAAAATCACTCTTGTTTATGTTATAAACCGGCGGCTGCTGCTGC
 
. : . : . : . : . : . :
JMSF044I10+ TGCTGAGGCGCCGCCGCCGCTTGCTGCTGCTGCAGGCTTTGAGCCACCGTATTCGCCGCC
JMSF004L12+ TGCTGAGGCGCCGCCGCCGCTTGCTGCTGCTGCAGGCTTTGAGCCACCGTATTCGCCGCC
JMSF044I09+ TGCTGAGGCGCCGCCGCCGCTTGCTGCTGCTGCAGGCTTTGAGCCACCGTATTCGCCGCC
                      ____________________________________________________________
consensus TGCTGAGGCGCCGCCGCCGCTTGCTGCTGCTGCAGGCTTTGAGCCACCGTATTCGCCGCC
 
. : . : . : . : . : . :
JMSF044I10+ GTGGCAGGCTGCGATTGCTGGGGCTCTAACTGAGAGCTTTGAACAGTGTGAATCTCATAA
JMSF004L12+ GTGGCAGGCTGCGATTGCTGGGGCTCTAACTGAGAGCTTTGAACAGTGTGAATCTCATAA
JMSF044I09+ GTGGCAGGCTGCGATTGCTGGGGCTCTAACTGAGAGCTTTGAACAGTGTGAATCTCATAA
                      ____________________________________________________________
consensus GTGGCAGGCTGCGATTGCTGGGGCTCTAACTGAGAGCTTTGAACAGTGTGAATCTCATAA
 
. : . : . : . : . : . :
JMSF044I10+ ACAGGGGGCTTCCGAATTGGTTTAGAGATCTTATGTGAAATCTTGTTCAGATGCTTCAAA
JMSF004L12+ ACAGGGGGCTTCCGAATTGGTTTAGAGATCTTATGTGAAATCTTGTTCAGATGCTTCAAA
JMSF044I09+ ACAGGGGGCTTCCGAATTGGTTTAGAGATCTTATGTGAAATCTTGTTCAGATGCTTCAAA
JMSF001A13+ TAGAGATCTTATGTGAAATCTTGTTCAGATGCTTCAAA
                      ____________________________________________________________
consensus ACAGGGGGCTTCCGAATTGGTTTAGAGATCTTATGTGAAATCTTGTTCAGATGCTTCAAA
 
. : . : . : . : . : . :
JMSF044I10+ TACGCCGCAGTAGAAGAAGAGTCGCCGCCGCCGCCACCACTATCATCCCCGGAGGAATCA
JMSF004L12+ TACGCCGCAGTAGAAGAAGAGTCGCCGCCGCCGCCACCACTATCATCCCCGGAGGAATCA
JMSF044I09+ TACGCCGCAGTAGAAGAAGAGTCGCCGCCGCCGCCACCACTATCATCCCCGGAGGAATCA
JMSF001A13+ TACGCCGCAGTAGAAGAAGAGTCGCCGCCGCCGCCACCACTATCATCCCCGGAGGAATCA
                      ____________________________________________________________
consensus TACGCCGCAGTAGAAGAAGAGTCGCCGCCGCCGCCACCACTATCATCCCCGGAGGAATCA
 
. : . : . : . : . : . :
JMSF044I10+ TACACTCTCTCCATATTTCCCCCTCTCTCTC
JMSF004L12+ TACACTCTCTCCATATTTCCCCCTCTCTCTC
JMSF044I09+ TACACTCTCTCCATATTTCCCCCTCTCTCTC
JMSF001A13+ TACACTCTCTCCATATTTCCCCCTCTCTCTCTCTCTCTAAAATTCACCTTCCTCTGTGTC
                      ____________________________________________________________
consensus TACACTCTCTCCATATTTCCCCCTCTCTCTCTCTCTCTAAAATTCACCTTCCTCTGTGTC