Previous Contig 004279:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001H17Sequence516004279 (7)671010511 (6)gb:AE016959_10215271e-55Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC09
JMFF017E18Sequence586004279 (7)666010511 (6)gb:AE016959_10215275e-46Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC09
JMFF023K16Sequence563004279 (7)661010511 (6)gb:AE016959_10215272e-50Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC09
JMFF045E08Sequence645004279 (7)sp|P35324|CORA_RABIT0.016Cornifin alpha (Small proline-rich protein I) (SPR-I).>pir|A46375|A46375 cornifi643010511 (6)gb:AE016959_10215279e-53Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC09
JMSF001A10Sequence205004279 (7)
JMSF001I04Sequence255004279 (7)711010511 (6)gb:AE016959_10215272e-60Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC09
JMSF008G18Sequence488004279 (7)693010511 (6)gb:AE016959_10215273e-57Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC09

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF017E18+ CGACGT
JMFF045E08+ TATAGTCACCGCCTTTGGTGCTCGACGT
                      ____________________________________________________________
consensus TATAGTCACCGCCTTTGGTGCTCGACGT
 
. : . : . : . : . : . :
JMFF001H17+ CGCAT
JMFF017E18+ ATGGTGCGGGCTGGGGAATCATGGGCCGGCACGGGTACCGCCCGCTAATCCAATCCGCAT
JMFF045E08+ ATGGTGCGGGCTGGGGAATCATGGGCCGGCACGGGTACCGCCCGCTAATCCAATCCGCAT
JMFF023K16+ CGCAT
                      ____________________________________________________________
consensus ATGGTGCGGGCTGGGGAATCATGGGCCGGCACGGGTACCGCCCGCTAATCCAATCCGCAT
 
. : . : . : . : . : . :
JMFF001H17+ GGGACGGGT-CCAAGCGGTGTTGGTGATCAAAGGGTAACGGCCGAGAAGGAGGCGGCGGC
JMFF017E18+ GGGACGGGT-CCAAGCGGTGTTGGTGATCAAAGGGTAACGGCCGAGAAGGAGGCGGCGGC
JMFF045E08+ GGGACGGGT-CCAAGCGGTGTTGGTGATCAAAGGGTAACGGCCGAGAAGGAGGCGGCGGC
JMFF023K16+ GGGACGGGTCCCAAGCGGTGTTGGTGATCAAAGGGTAACGGCCGAGAAGGAGGCGGCGGC
                      ____________________________________________________________
consensus GGGACGGGT-CCAAGCGGTGTTGGTGATCAAAGGGTAACGGCCGAGAAGGAGGCGGCGGC
 
. : . : . : . : . : . :
JMFF001H17+ GGCTGATAGTAGGGCGGGTACTGGTAATACGGCGGCGCGTTAGGGTTGGGGTATTGGGAA
JMFF017E18+ GGCTGATAGTAGGGCGGGTACTGGTAATACGGCGGCGCGTTAGGGTTGGGGTATTGGGAA
JMFF045E08+ GGCTGATAGTAGGGCGGGTACTGGTAATACGGCGGCGCGTTAGGGTTGGGGTATTGGGAA
JMFF023K16+ GGCTGATAGTAGGGCGGGTACTGGTAATACGGCGGCGCGTTAGGGTTGGGGTATTGGGAA
JMSF008G18+ GGTACTGGTAATACGGCGGCGCGTTAGGGTTGGGGTATTGGGAA
                      ____________________________________________________________
consensus GGCTGATAGTAGGGCGGGTACTGGTAATACGGCGGCGCGTTAGGGTTGGGGTATTGGGAA
 
. : . : . : . : . : . :
JMFF001H17+ GGGTAAGGCGTCGCAGCAGCAAACACGTACTGGTTGGCGCTGATCTCAGGCTGCGGCTGC
JMFF017E18+ GGGTAAGGCGTCGCAGCAGCAAACACGTACTGGTTGGCGCTGATCTCAGGCTGCGGCTGC
JMFF045E08+ GGGTAAGGCGTCGCAGCAGCAAACACGTACTGGTTGGCGCTGATCTCAGGCTGCGGCTGC
JMFF023K16+ GGGTAAGGCGTCGCAGCAGCAAACACGTACTGGTTGGCGCTGATCTCAGGCTGCGGCTGC
JMSF008G18+ GGGTAAGGCGTCGCAGCAGCAAACACGTACTGGTTGGCGCTGATCTCAGGCTGCGGCTGC
                      ____________________________________________________________
consensus GGGTAAGGCGTCGCAGCAGCAAACACGTACTGGTTGGCGCTGATCTCAGGCTGCGGCTGC
 
. : . : . : . : . : . :
JMFF001H17+ GGCTGAGGCGGTGGCGGTGGAGGCGGCGGCGGGTGCCTCCTCCGACTGCTATTGCTTCTT
JMFF017E18+ GGCTGAGGCGGTGGCGGTGGAGGCGGCGGCGGGTGCCTCCTCCGACTGCTATTGCTTCTT
JMFF045E08+ GGCTGAGGCGGTGGCGGTGGAGGCGGCGGCGGGTGCCTCCTCCGACTGCTATTGCTTCTT
JMFF023K16+ GGCTGAGGCGGTGGCGGTGGAGGCGGCGGCGGGTGCCTCCTCCGACTGCTATTGCTTCTT
JMSF008G18+ GGCTGAGGCGGTGGCGGTGGAGGCGGCGGCGGGTGCCTCCTCCGACTGCTATTGCTTCTT
                      ____________________________________________________________
consensus GGCTGAGGCGGTGGCGGTGGAGGCGGCGGCGGGTGCCTCCTCCGACTGCTATTGCTTCTT
 
. : . : . : . : . : . :
JMFF001H17+ CGCCGCCCGTTCACTCCACTGCTTCCGACGTTACCCATCTCACAAGCTTCCTCCTTTCTC
JMSF001I04+ GACGNTACCCATCTCACAAGCTTCCTCCTTTCTC
JMFF017E18+ CGCCGCCCGTTCACTCCACTGCTTCCGACGTTACCCATCTCACAAGCTTCCTCCTTTCTC
JMFF045E08+ CGCCGCCCGTTCACTCCACTGCTTCCGACGTTACCCATCTCACAAGCTTCCTCCTTTCTC
JMFF023K16+ CGCCGCCCGTTCACTCCACTGCTTCCGACGTTACCCATCTCACAAGCTTCCTCCTTTCTC
JMSF008G18+ CGCCGCCCGTTCACTCCACTGCTTCCGACGTTACCCATCTCACAAGCTTCCTCCTTTCTC
                      ____________________________________________________________
consensus CGCCGCCCGTTCACTCCACTGCTTCCGACGTTACCCATCTCACAAGCTTCCTCCTTTCTC
 
. : . : . : . : . : . :
JMFF001H17+ CAGAACCAAATCTATCATCAAAATTCCAAGTAAAGCAAAACCCGAACTAGTATTTCTCAG
JMSF001I04+ CAGAACCAAATCTATCATCAAAATTCCAAGTAAAGCAAAACCCGAACTAGTATTTCTCAG
JMFF017E18+ CAGAACCAAATCTATCATCAAAATTCCAAGTAAAGCAAAACCCGAACTAGTATTTCTCAG
JMFF045E08+ CAGAACCAAATCTATCATCAAAATTCCAAGTAAAGCAAAACCCGAACTAGTATTTCTCAG
JMFF023K16+ CAGAACCAAATCTATCATCAAAATTCCAAGTAAAGCAAAACCCGAACTAGTATTTCTCAG
JMSF008G18+ CAGAACCAAATCTATCATCAAAATTCCAAGTAAAGCAAAACCCGAACTAGTATTTCTCAG
                      ____________________________________________________________
consensus CAGAACCAAATCTATCATCAAAATTCCAAGTAAAGCAAAACCCGAACTAGTATTTCTCAG
 
. : . : . : . : . : . :
JMFF001H17+ GAATTCAGAGCCGGGAGTCACAAAATTCCTGCTTTTTCCCCGATCCGAAAGGAAACGATA
JMSF001I04+ GAATTCAGAGCCGGGAGTCACAAAATTCCTGCTTTTTCCCCGATCCGAAAGGAAACGATA
JMFF017E18+ GAATTCAGAGCCGGGAGTCACAAAATTCCTGCTTTTTCCCCGATCCGAAAGGAAACGATA
JMFF045E08+ GAATTCAGAGCCGGGAGTCACAAAATTCCTGCTTTTTCCCCGATCCGAAAGGAAACGATA
JMFF023K16+ GAATTCAGAGCCGGGAGTCACAAAATTCCTGCTTTTTCCCCGATCCGAAAGGAAACGATA
JMSF008G18+ GAATTCAGAGCCGGGAGTCACAAAATTCCTGCTTTTTCCCCGATCCGAAAGGAAACGATA
                      ____________________________________________________________
consensus GAATTCAGAGCCGGGAGTCACAAAATTCCTGCTTTTTCCCCGATCCGAAAGGAAACGATA
 
. : . : . : . : . : . :
JMFF001H17+ TGTTATAGCTCAAGATAGGAACATCCTGAGTTAGGTTCTGAGAGAGAGAAAATTGAGGGT
JMSF001I04+ TGTTATAGCTCAAGATAGGAACATCCTGAGTTAGGTTCTGAGAGAGAGAAAATTGAGGGT
JMFF017E18+ TGTTATAGCTCAAGATAGGAACATCCTGAGTTAGGTTCTGAGAGAGAGAAAATTGAGGGT
JMFF045E08+ TGTTATAGCTCAAGATAGGAACATCCTGAGTTAGGTTCTGAGAGAGAGAAAATTGAGGGT
JMFF023K16+ TGTTATAGCTCAAGATAGGAACATCCTGAGTTAGGTTCTGAGAGAGAGAAAATTGAGGGT
JMSF008G18+ TGTTATAGCTCAAGATAGGAACATCCTGAGTTAGGTTCTGAGAGAGAGAAAATTGAGGGT
JMSF001A10+ TTCTGAGAGAGAGAAAATTGAGGGT
                      ____________________________________________________________
consensus TGTTATAGCTCAAGATAGGAACATCCTGAGTTAGGTTCTGAGAGAGAGAAAATTGAGGGT
 
. : . : . : . : . : . :
JMFF001H17+ AGGTTCACATCCAATTATTGATGGT
JMSF001I04+ AGGTTCACATCCAATTATTGATGGTGGTAGAGAAT
JMFF017E18+ AGGTTCACATCCAATTATTGATGGTGGTAGAGAATAGGAT
JMFF045E08+ AGGTTCACATCCAATTATTGATGGTGGTAGAGAATAGGATGGAACAAGAAAGCTACGGTG
JMFF023K16+ AGGTTCACATCCAATTATTGATGGTGGTAGAGAATAGGATGGAACAAGAAAGCTACGGTG
JMSF008G18+ AGGTTCACATCCAATTATTGATGGTGGTAGAGAATAGGATGGAACAAGAAAGCTACGGTG
JMSF001A10+ AGGTTCACATCCAATTATTGATGGTGGTAGAGAATAGGATGGAACAAGAAAGCTACGGTG
                      ____________________________________________________________
consensus AGGTTCACATCCAATTATTGATGGTGGTAGAGAATAGGATGGAACAAGAAAGCTACGGTG
 
. : . : . : . : . : . :
JMFF045E08+ AAGAAGAAGAAGAAGAA
JMFF023K16+ AAGAAGAAGAAGAAGAA
JMSF008G18+ AAGAAGAAGAAGAAGAA
JMSF001A10+ AAGAAGAAGAAGAAGAACGGGGGTTGCGTAAAGTTGCATACAGAACGAATAACATTAATG
                      ____________________________________________________________
consensus AAGAAGAAGAAGAAGAACGGGGGTTGCGTAAAGTTGCATACAGAACGAATAACATTAATG
 
. : . : . : . : . : . :
JMSF001A10+ AATCGGAGGGAAAAATTGGGTACAGCTGAGATGAGCTGCTTTGCTTTTGCAGTTCATGCC
                      ____________________________________________________________
consensus AATCGGAGGGAAAAATTGGGTACAGCTGAGATGAGCTGCTTTGCTTTTGCAGTTCATGCC