Previous Contig 004277:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS169G12Sequence604004277 (2)gb:AB019232_15141756e-58Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIL23.>gb:AY052198_156
JMFS169H12Sequence617004277 (2)gb:AB019232_15141751e-58Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIL23.>gb:AY052198_156

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS169H12+ ATTATTCATGCAATCTTG
JMFS169G12+ TCTTG
                      ____________________________________________________________
consensus ATTATTCATGCAATCTTG
 
. : . : . : . : . : . :
JMFS169H12+ GTATGTACTATATGTAGTGGAAATTCGACGACTCCGAGGTTATTTAGTTTTGTCG-TCAA
JMFS169G12+ GTATGTACTATATGTAGTGGAAATTCGACGACTCCGAGGTTATTTAG-TTTGTCGNTCAA
                      ____________________________________________________________
consensus GTATGTACTATATGTAGTGGAAATTCGACGACTCCGAGGTTATTTAGTTTTGTCGNTCAA
 
. : . : . : . : . : . :
JMFS169H12+ CCTGTTCCTGAGGATACCCAATGCCATGGCGCCTGTTCGGGAAAATCATAAATACGGAGC
JMFS169G12+ CCTGTTCCTGAGGATACCCAATGCCATGGCGCCTGTTCGGGAAAATCATAAATACGGAGC
                      ____________________________________________________________
consensus CCTGTTCCTGAGGATACCCAATGCCATGGCGCCTGTTCGGGAAAATCATAAATACGGAGC
 
. : . : . : . : . : . :
JMFS169H12+ CGGAAACGGCGCCGATTACCGGCGGCAACACCATGAGCAGAACCTTCTGGGTGGACTCGA
JMFS169G12+ CGGAAACGGCGCCGATTACCGGCGGCAACACCATGAGCAGAACCTTCTGGGTGGACTCGA
                      ____________________________________________________________
consensus CGGAAACGGCGCCGATTACCGGCGGCAACACCATGAGCAGAACCTTCTGGGTGGACTCGA
 
. : . : . : . : . : . :
JMFS169H12+ ACGCCGGGTAATAACAATCCACAGTGTTGCGGTCCAAAAGCACGAGCGCCCCGAAAACCA
JMFS169G12+ ACGCCGGGTAATAACAATCCACAGTGTTGCGGTCCAAAAGCACGAGCGCCCCGAAAACCA
                      ____________________________________________________________
consensus ACGCCGGGTAATAACAATCCACAGTGTTGCGGTCCAAAAGCACGAGCGCCCCGAAAACCA
 
. : . : . : . : . : . :
JMFS169H12+ GCATCGTAAACGCGGCGTGGACGAAGTCTCCGAGCCGGATTCTGAACGCCGACCAGTCGC
JMFS169G12+ GCATCGTAAACGCGGCGTGGACGAAGTCTCCGAGCCGGATTCTGAACGCCGACCAGTCGC
                      ____________________________________________________________
consensus GCATCGTAAACGCGGCGTGGACGAAGTCTCCGAGCCGGATTCTGAACGCCGACCAGTCGC
 
. : . : . : . : . : . :
JMFS169H12+ CGCCGTCGCCGGGGGACGGCCAGAGCCCCTTGGCCGTGGCGACGGCGTAGTGCGTCTGGC
JMFS169G12+ CGCCGTCGCCGGGGGACGGCCAGAGCCCCTTGGCCGTGGCGACGGCGTAGTGCGTCTGGC
                      ____________________________________________________________
consensus CGCCGTCGCCGGGGGACGGCCAGAGCCCCTTGGCCGTGGCGACGGCGTAGTGCGTCTGGC
 
. : . : . : . : . : . :
JMFS169H12+ CTTGGTCGTCGGTGTAGCTGTCGGTGAAGCTGGAGAAGCCGCAGGAGAAGCCGCAGATGG
JMFS169G12+ CTTGGTCGTCGGTGTAGCTGTCGGTGAAGCTGGAGAAGCCGCAGGAGAAGCCGCAGATGG
                      ____________________________________________________________
consensus CTTGGTCGTCGGTGTAGCTGTCGGTGAAGCTGGAGAAGCCGCAGGAGAAGCCGCAGATGG
 
. : . : . : . : . : . :
JMFS169H12+ CGATGAGGGCGGCGGAGAGCCACTTGTTCACGGCGGCGCATTGGCCGTTGTTGGTCAGGA
JMFS169G12+ CGATGAGGGCGGCGGAGAGCCACTTGTTCACGGCGGCGCATTGGCCGTTGTTGGTCAGGA
                      ____________________________________________________________
consensus CGATGAGGGCGGCGGAGAGCCACTTGTTCACGGCGGCGCATTGGCCGTTGTTGGTCAGGA
 
. : . : . : . : . : . :
JMFS169H12+ CGGGGTTGAGGAACTGGAATATGAAGACGGTGCCGGTGGGGAGCAGGCGTATGAGGTTTC
JMFS169G12+ CGGGGTTGAGGAACTGGAATATGAAGACGGTGCCGGTGGGGAGCAGGCGTATGAGGTTTC
                      ____________________________________________________________
consensus CGGGGTTGAGGAACTGGAATATGAAGACGGTGCCGGTGGGGAGCAGGCGTATGAGGTTTC
 
. : . : . : . : . : . :
JMFS169H12+ CGACGCCGGTTAGCGTCTTTTCTTGAATGCTTTTCCCGGAGTTAGCCATTTTACTGAGTT
JMFS169G12+ CGACGCCGGTTAGCGTCTTTTCTTGAATGCTTTTCCCGGAGTTAGCCATTTTACTGAGTT
                      ____________________________________________________________
consensus CGACGCCGGTTAGCGTCTTTTCTTGAATGCTTTTCCCGGAGTTAGCCATTTTACTGAGTT