Previous Contig 004268:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS137H09Sequence613004268 (2)gb:AY070134_15667489e-36Arabidopsis thaliana AT5g10020/T31P16_9 mRNA, complete cds.
JMFS168E06Sequence642004268 (2)gb:AY070134_15667481e-32Arabidopsis thaliana AT5g10020/T31P16_9 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS137H09+ ATGGAATGCAAA
                      ____________________________________________________________
consensus ATGGAATGCAAA
 
. : . : . : . : . : . :
JMFS137H09+ TCAAGCACTCTAAGCTGCTGCAAATTCCAAATTCCGCTCGGAAAGCCGCCGGAGAAATTG
JMFS168E06+ TGCAAATTCCAAATTCCGCTCGGAAAGCCGCCGNAGAAATTG
                      ____________________________________________________________
consensus TCAAGCACTCTAAGCTGCTGCAAATTCCAAATTCCGCTCGGAAAGCCGCCGGAGAAATTG
 
. : . : . : . : . : . :
JMFS137H09+ TTACTGGACAAGTTAAGATAATTCAAACCCCAGAGATCATTAAGGCGGGCGGGGACAGGC
JMFS168E06+ TTACTGGACAAGTTAAGATAATTCAAACCCCAGAGATCATTAAGGCGGGCGGGGACAGGC
                      ____________________________________________________________
consensus TTACTGGACAAGTTAAGATAATTCAAACCCCAGAGATCATTAAGGCGGGCGGGGACAGGC
 
. : . : . : . : . : . :
JMFS137H09+ CCGTAGAACTGGTTCCCGGAGAGATCCAAGTACTGGAGGGAGGTCATGTAACCTATGGCG
JMFS168E06+ CCGTAGAACTGGTTCCCGGAGAGATCCAAGTACTGGAGGGAGGTCATGTAACCTATGGCG
                      ____________________________________________________________
consensus CCGTAGAACTGGTTCCCGGAGAGATCCAAGTACTGGAGGGAGGTCATGTAACCTATGGCG
 
. : . : . : . : . : . :
JMFS137H09+ GGTACGACCCGACCCGTGAATGAATTACCCGAAAGGCTAAGGTTTCTGAGGTGCTTAAGC
JMFS168E06+ GGTACGACCCGACCCGTGAATGAATTACCCGAAAGGCTAAGGTTTCTGAGGTGCTTAAGC
                      ____________________________________________________________
consensus GGTACGACCCGACCCGTGAATGAATTACCCGAAAGGCTAAGGTTTCTGAGGTGCTTAAGC
 
. : . : . : . : . : . :
JMFS137H09+ CCAGTGAGCGTGGAGAACCTCAAGTCACCGGCTAAGCCGAGGCGGTCGAGGGCAATGGCG
JMFS168E06+ CCAGTGAGCGTGGAGAACCTCAAGTCACCGGCTAAGCCGAGGCGGTCGAGGGCAATGGCG
                      ____________________________________________________________
consensus CCAGTGAGCGTGGAGAACCTCAAGTCACCGGCTAAGCCGAGGCGGTCGAGGGCAATGGCG
 
. : . : . : . : . : . :
JMFS137H09+ GAGACGGAACCGGAGGCGGAGTCGCAAACGACGCCGTAGAACATGTCGGGGCACGAGGAG
JMFS168E06+ GAGACGGAACCGGAGGCGGAGTCGCAAACGACGCCGTAGAACATGTCGGGGCACGAGGAG
                      ____________________________________________________________
consensus GAGACGGAACCGGAGGCGGAGTCGCAAACGACGCCGTAGAACATGTCGGGGCACGAGGAG
 
. : . : . : . : . : . :
JMFS137H09+ AGATCGGAGAGAAGGGTGAGGTTCCATGAGGCCAAGATTTTCCCCAATGGATCCGATTTT
JMFS168E06+ AGATCGGAGAGAAGGGTGAGGTTCCATGAGGCCAAGATTTTCCCCAATGGATCCGATTTT
                      ____________________________________________________________
consensus AGATCGGAGAGAAGGGTGAGGTTCCATGAGGCCAAGATTTTCCCCAATGGATCCGATTTT
 
. : . : . : . : . : . :
JMFS137H09+ ATCCCCTTCCTGAACTCCAAGAGTGAACGGAGTTCCTCCTCGGCGGCAAATGCGCAGCGG
JMFS168E06+ ATCCCCTTCCTGAACTCCAAGAGTGAACGGAGTTCCTCCTCGGCGGCAAATGCGCAGCGG
                      ____________________________________________________________
consensus ATCCCCTTCCTGAACTCCAAGAGTGAACGGAGTTCCTCCTCGGCGGCAAATGCGCAGCGG
 
. : . : . : . : . : . :
JMFS137H09+ AAACAGCAAAAGATGAGAAGAAAAACAGTAACAGAACGCGACATTGGAGTTTGCAGAGAA
JMFS168E06+ AAACAGCAAAAGATGAGAAGAAAAACAGTAACAGAACGCGACATTGGAGTTTGCAGAGAA
                      ____________________________________________________________
consensus AAACAGCAAAAGATGAGAAGAAAAACAGTAACAGAACGCGACATTGGAGTTTGCAGAGAA
 
. : . : . : . : . : . :
JMFS137H09+ AGAGAATTGTGTTATGAACGAGGCATTAAGATTATCAGAATCAGAGAGTTTGCAGAGAAA
JMFS168E06+ AGAGAATTGTGTTATGAACGAGGCATTAAGATTATCAGAATCAGAGAGTTTGCAGAGAAA
                      ____________________________________________________________
consensus AGAGAATTGTGTTATGAACGAGGCATTAAGATTATCAGAATCAGAGAGTTTGCAGAGAAA
 
. : . : . : . : . : . :
JMFS137H09+ A
JMFS168E06+ AGACTAAAACGAAGCTTTCTGCTGCTTCCATTCCATCTGCCCAGTAGAAATGGAACTGTG
                      ____________________________________________________________
consensus AGACTAAAACGAAGCTTTCTGCTGCTTCCATTCCATCTGCCCAGTAGAAATGGAACTGTG