Previous Contig 004267:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS168E04Sequence614004267 (2)gb:AY133551_15813742e-50Arabidopsis thaliana At1g42440/F7F22_7 mRNA, complete cds.>gb:BT000755_1635027 A
JMSF006L17Sequence391018487gb:AY133551_15813749e-21Arabidopsis thaliana At1g42440/F7F22_7 mRNA, complete cds.>gb:BT000755_1635027 A252004267 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS168E04- AAGACTGATGGAGA
                      ____________________________________________________________
consensus AAGACTGATGGAGA
 
. : . : . : . : . : . :
JMFS168E04- ATCTACTTCATTGGCTGTTGCCGCTGTTGGTTCCTTGAGAAGTATTGACCCTAATAGAAT
                      ____________________________________________________________
consensus ATCTACTTCATTGGCTGTTGCCGCTGTTGGTTCCTTGAGAAGTATTGACCCTAATAGAAT
 
. : . : . : . : . : . :
JMFS168E04- TATTCTGAAGAAAATTATTTTGACTGGTTACCCTCAAAGAGTGTCAAAAATGAGAGCCTC
                      ____________________________________________________________
consensus TATTCTGAAGAAAATTATTTTGACTGGTTACCCTCAAAGAGTGTCAAAAATGAGAGCCTC
 
. : . : . : . : . : . :
JMFS168E04- TGTTAGATACATGTTTCACAGTCCCGATGATGTGAGATGGTTCAAGCCTGTTGAGGTTTG
                      ____________________________________________________________
consensus TGTTAGATACATGTTTCACAGTCCCGATGATGTGAGATGGTTCAAGCCTGTTGAGGTTTG
 
. : . : . : . : . : . :
JMFS168E04- GACAAAGTGTGGTCGCCGTGGTCGTATTAGGGAACCTCTTGGCACACATGGGGCAATGAA
                      ____________________________________________________________
consensus GACAAAGTGTGGTCGCCGTGGTCGTATTAGGGAACCTCTTGGCACACATGGGGCAATGAA
 
. : . : . : . : . : . :
rJMSF006L17+ GAGTTTGTTCAAACG
JMFS168E04- GTGCGTTTTCAATGGAGTCCTCCAGCAGCACGACACTGTATGCATGAGTTTGTTCAAACG
                      ____________________________________________________________
consensus GTGCGTTTTCAATGGAGTCCTCCAGCAGCACGACACTGTATGCATGAGTTTGTTCAAACG
 
. : . : . : . : . : . :
rJMSF006L17+ NGCATNCCCCCGCTGGCCGAACCNGTGGTNCCCAATTGGCGCTTAGCTTTTAAANCGGTT
JMFS168E04- TGCATACCCCCGCTGGCCGAACCAGTGGTACCCAATTGGCGCTTAGCTTTTAAAGCGGTT
                      ____________________________________________________________
consensus TGCATACCCCCGCTGGCCGAACCAGTGGTACCCAATTGGCGCTTAGCTTTTAAAGCGGTT
 
. : . : . : . : . : . :
rJMSF006L17+ CCNTNTGGGATCNGGGAGGGNTGGCNNTCTTGGTTCTTTATGNTAATTAANGGGAANGAA
JMFS168E04- CCATCTGGGATCGGGGAGGGTTGGCATTCTTGTTTCTTTATGCTAATTAATGGGAATGAA
                      ____________________________________________________________
consensus CCATCTGGGATCGGGGAGGGTTGGCATTCTTGTTTCTTTATGCTAATTAATGGGAATGAA
 
. : . : . : . : . : . :
rJMSF006L17+ GCTNTGGTTCAGAATNGGCTNTTCNTTGTGTCCGATGGCAAGNANNTNCNTGCAACCNAG
JMFS168E04- GCTCTGGTTCAGAATAGGCTATTCATTGTGTCCGATGGCAAGAAGCTACATGCAACCAAG
                      ____________________________________________________________
consensus GCTCTGGTTCAGAATAGGCTATTCATTGTGTCCGATGGCAAGAAGCTACATGCAACCAAG
 
. : . : . : . : . : . :
rJMSF006L17+ NGCCNAATGCCTTGTTTTTGCCAGATATGTGNATAGCCAAAAATTTTGCATACG
JMFS168E04- TGCCAAATGCCTTGTTTTTGCTAGATATGTGTATAGCCAAAAATTTTGCATACGCTTCTA
                      ____________________________________________________________
consensus TGCCAAATGCCTTGTTTTTGCTAGATATGTGTATAGCCAAAAATTTTGCATACGCTTCTA
 
. : . : . : . : . : . :
JMFS168E04- TTTATCTATGTATTCTATAAGTATTATTGGGGTAAAAGGCTCCTGCCTTAATTGGATACA
                      ____________________________________________________________
consensus TTTATCTATGTATTCTATAAGTATTATTGGGGTAAAAGGCTCCTGCCTTAATTGGATACA