Previous Contig 004265:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002K23Sequence264004265 (6)gb:ATAC013483_15435610.004Arabidopsis thaliana chromosome III BAC F17A17 genomic sequence, complete sequen535010393 (12)gb:AP003489_18299154e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P056
JMFF038H04Sequence504004265 (6)gb:BT004663_16376977e-11Arabidopsis thaliana At1g52821 gene, complete cds.>gb:AK117948_1815955 Arabidops714009992 (3)gb:BT004663_16376975e-09Arabidopsis thaliana At1g52821 gene, complete cds.>gb:AK117948_1815955 Arabidops
JMFS155A05Sequence592004265 (6)gb:AP003489_18299157e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P056
JMFS162E11Sequence618004265 (6)gb:AP003489_18299158e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P056
JMFS168D08Sequence629004265 (6)gb:AP003489_18299158e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P056
JMSF052G21Sequence713005217 (6)gb:AY063068_15656452e-56Arabidopsis thaliana unknown protein (At1g12730) mRNA, complete cds.>gb:AF370252869004265 (6)gb:AY065088_15662425e-65Arabidopsis thaliana unknown protein (At1g63110) mRNA, complete cds.>gb:AY128722

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF052G21+ TTTATTCTAACTGTAAAAGATT
                      ____________________________________________________________
consensus TTTATTCTAACTGTAAAAGATT
 
. : . : . : . : . : . :
rJMSF052G21+ TATCCCCAAATATAGGTGTCTTATGGTATTTCTTTGCTGAAGTCTTTGATTTCTTCAGAA
                      ____________________________________________________________
consensus TATCCCCAAATATAGGTGTCTTATGGTATTTCTTTGCTGAAGTCTTTGATTTCTTCAGAA
 
. : . : . : . : . : . :
rJMSF052G21+ GCTTTTTTCTTATAGTTTTTCATGTAAACATCCTCTTCATGATCCTGCCATTAGCCATGC
                      ____________________________________________________________
consensus GCTTTTTTCTTATAGTTTTTCATGTAAACATCCTCTTCATGATCCTGCCATTAGCCATGC
 
. : . : . : . : . : . :
rJMSF052G21+ GACTATACAACAGGCCCTGCTTTCTGGCTTTTGTTTACATGGCAATATGTTCAATGCTTA
                      ____________________________________________________________
consensus GACTATACAACAGGCCCTGCTTTCTGGCTTTTGTTTACATGGCAATATGTTCAATGCTTA
 
. : . : . : . : . : . :
rJMSF052G21+ AATCTTATCCTTCAGTTGGAGACTCGGCTTTATACTTGGGTTTATTGGCTTTGTTTATCA
                      ____________________________________________________________
consensus AATCTTATCCTTCAGTTGGAGACTCGGCTTTATACTTGGGTTTATTGGCTTTGTTTATCA
 
. : . : . : . : . : . :
rJMSF052G21+ ACGAATTGTCAGAAATGCCATTTTCTTTCTTCCTATTCTGTGGATATGTGGGTGTCTCCC
                      ____________________________________________________________
consensus ACGAATTGTCAGAAATGCCATTTTCTTTCTTCCTATTCTGTGGATATGTGGGTGTCTCCC
 
. : . : . : . : . : . :
rJMSF052G21+ TTTTAAGCCCAGTAATGCACAACCTATGGATATGGAGGGGTACTGGAAATGCAAACTTCT
                      ____________________________________________________________
consensus TTTTAAGCCCAGTAATGCACAACCTATGGATATGGAGGGGTACTGGAAATGCAAACTTCT
 
. : . : . : . : . : . :
JMFF038H04- GGTGAGGTAGTGGGCTTTGCTCGGA
rJMSF052G21+ ATTTTGCAACTGCTATGGGATACGCCTGCTTCCAGGGTGAGGTAGTGGGCTTTGCTCGGA
                      ____________________________________________________________
consensus ATTTTGCAACTGCTATGGGATACGCCTGCTTCCAGGGTGAGGTAGTGGGCTTTGCTCGGA
 
. : . : . : . : . : . :
JMFF038H04- ACAGGAGGACGACGCCGGAGCTCGAACTGCGCCGCCATCGGAGCCTCCAC
rJMSF052G21+ ACAGGAGGACGATGCCGGAGCTCGAATCGCACCGCCATCGGAGCCTCCACGCGCCGCCGC
                      ____________________________________________________________
consensus ACAGGAGGACGATGCCGGAGCTCGAATTGCGCCGCCATCGGAGCCTCCACGCGCCGCCGC
 
. : . : . : . : . : . :
rJMSF052G21+ CGCCGCTGCTCCGACGCCACGCGCCGGCGCGTGAGGCAGATTCCGGCGTCTTCTCCGGCT
                      ____________________________________________________________
consensus CGCCGCTGCTCCGACGCCACGCGCCGGCGCGTGAGGCAGATTCCGGCGTCTTCTCCGGCT
 
. : . : . : . : . : . :
rJMSF052G21+ GAAAATTACACCGGTGAACTCGCCTTAGTGTGTAGGTTCTGCCCATGTATGTTTTGTGGG
JMFS162E11+ TGCCCATGTATGTTTTGTGGG
                      ____________________________________________________________
consensus GAAAATTACACCGGTGAACTCGCCTTAGTGTGTAGGTTCTGCCCATGTATGTTTTGTGGG
 
. : . : . : . : . : . :
rJMSF052G21+ GTTTTGGGTTGTATTTTGCACTTAGGCGAGGCGAGCGGACTAGGCGCAAGGCCGTGACCG
JMFS162E11+ GTTNTGAGTTGTATTTTGCACTTAGGCGAGGCGAGCGAACTAGGCGCAAGGCCGTGACCG
                      ____________________________________________________________
consensus GTTTTGGGTTGTATTTTGCACTTAGGCGAGGCGAGCGGACTAGGCGCAAGGCCGTGACCG
 
. : . : . : . : . : . :
rJMSF052G21+ CCCAGACGCCTAGCCGGCGCCTAGGCGTCGCCTTGATAACCCTG
JMFS162E11+ CCCAGACGCCTAGGCGGCGCCTAGGCGACGCCTTGATAACCCTGGTTTGGATAACTATAT
JMFS168D08+ AT
                      ____________________________________________________________
consensus CCCAGACGCCTAGGCGGCGCCTAGGCGTCGCCTTGATAACCCTGGTTTGGATAACTATAT
 
. : . : . : . : . : . :
JMFS155A05+ CTAAATTCCAAGAGTAAGGATTCCAGTATAGGGTCTTCCCATCTTTCTCAACATGAAA
JMFS162E11+ ACCTAAATTCCAAGAGTAAGGATTCCAGTATAGGGTCTTCCCATCTTTCTCAACATGAAA
JMFS168D08+ ACCTAAATTCCAAGAGTAAGGATTCCAGTATAGGGTCTTCCCATCTTTCTCAACATGAAA
                      ____________________________________________________________
consensus ACCTAAATTCCAAGAGTAAGGATTCCAGTATAGGGTCTTCCCATCTTTCTCAACATGAAA
 
. : . : . : . : . : . :
JMFS155A05+ AGGTCCAAGTTCCTCAGCCAATCCATAAGCAATTGATGAACATCCAGGCCCTCCATTGAG
JMFS162E11+ AGGTCCAAGTTCCTCAGCCAATCCATAAGCAATTGATGAACATCCAGGCCCTCCATTGAG
JMFS168D08+ AGGTCCAAGTTCCTCAGCCAATCCATAAGCAATTGATGAACATCCAGGCCCTCCATTGAG
                      ____________________________________________________________
consensus AGGTCCAAGTTCCTCAGCCAATCCATAAGCAATTGATGAACATCCAGGCCCTCCATTGAG
 
. : . : . : . : . : . :
JMFS155A05+ CCAAAGAACAAGAGGCTTAGAAGAAGGGTCCACCACAGCCTCAAAGAACCAATAAAAAAG
JMFS162E11+ CCAAAGAACAAGAGGCTTAGAAGAAGGGTCCACCACAGCCTCAAAGAACCAATAAAAAAG
JMFS168D08+ CCAAAGAACAAGAGGCTTAGAAGAAGGGTCCACCACAGCCTCAAAGAACCAATAAAAAAG
                      ____________________________________________________________
consensus CCAAAGAACAAGAGGCTTAGAAGAAGGGTCCACCACAGCCTCAAAGAACCAATAAAAAAG
 
. : . : . : . : . : . :
JMFS155A05+ TGCTCTCCCAGACTCCTGGTTCACAGTCACATACCCAGAATACTGTGCAAAGCTGACATT
JMFF002K23+ TCACAGTCACATACCCAGAATACTGTGCAAAGCTGACATT
JMFS162E11+ TGCTCTCCCAGACTCCTGGTTCACAGTCACATACCCAGAATACTGTGCAAAGCTGACATT
JMFS168D08+ TGCTCTCCCAGACTCCTGGTTCACAGTCACATACCCAGAATACTGTGCAAAGCTGACATT
                      ____________________________________________________________
consensus TGCTCTCCCAGACTCCTGGTTCACAGTCACATACCCAGAATACTGTGCAAAGCTGACATT
 
. : . : . : . : . : . :
JMFS155A05+ GAAGCCAAGCCCTGGCAAATCCAAGACTGCGTCCAGTTTTTGCTGATCCACAGAAGAAGA
JMFF002K23+ GAAGCCAAGCCCTGGCAAATCCAAGACTGCGTCCAGTTTTTGCTGATCCACAGAAGAAGA
JMFS162E11+ GAAGCCAAGCCCTGGCAAATCCAAGACTGCGTCCAGTTTTTGCTGATCCACAGAAGAAGA
JMFS168D08+ GAAGCCAAGCCCTGGCAAATCCAAGACTGCGTCCAGTTTTTGCTGATCCACAGAAGAAGA
                      ____________________________________________________________
consensus GAAGCCAAGCCCTGGCAAATCCAAGACTGCGTCCAGTTTTTGCTGATCCACAGAAGAAGA
 
. : . : . : . : . : . :
JMFS155A05+ CCCTTTCCCACCATCAATACTGGTGGCGAGGAGAAGCACAAAGAGAAGACTGCAACCCCA
JMFF002K23+ CCCTTTCCCACCATCAATACTGGTGGCGAGGAGAAGCACAAAGAGAAGACTGCAACCCCA
JMFS162E11+ CCCTTTCCCACCATCAATACTGGTGGCGAGGAGAAGCACAAAGAGAAGACTGCAACCCCA
JMFS168D08+ CCCTTTCCCACCATCAATACTGGTGGCGAGGAGAAGCACAAAGAGAAGACTGCAACCCCA
                      ____________________________________________________________
consensus CCCTTTCCCACCATCAATACTGGTGGCGAGGAGAAGCACAAAGAGAAGACTGCAACCCCA
 
. : . : . : . : . : . :
JMFS155A05+ GCTCTGGGCAGACATTTCCAGTGGAATTTTGGTGAGACACAAGAATCCCCCTTTCT
JMFF002K23+ GCTCTGGGCAGACATTTCCAGTGGAATTTTGGTGAGACACAAGAATCCCCCTTTCTTGAA
JMFS162E11+ GCTCTGGGCAGACATTTCCAGTGGAATTTTGGTGAGACACAAGAATCCCCCTTTCTTGAA
JMFS168D08+ GCTCTGGGCAGACATTTCCAGTGGAATTTTGGTGAGACACAAGAATCCCCCTTTCTTGAA
                      ____________________________________________________________
consensus GCTCTGGGCAGACATTTCCAGTGGAATTTTGGTGAGACACAAGAATCCCCCTTTCTTGAA
 
. : . : . : . : . : . :
JMFF002K23+ TC
JMFS162E11+ TCGGATTGAATGAAGACTATATAATAAGATAGAGGGTTGTTCTGAGTCTTTGTTAAA
JMFS168D08+ TCGGATTGAATGAAGACTATATAATAAGATAGAGGGTTGTTCTGAGTCTTTGTTAAAGCC
                      ____________________________________________________________
consensus TCGGATTGAATGAAGACTATATAATAAGATAGAGGGTTGTTCTGAGTCTTTGTTAAAGCC