Previous Contig 004264:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014M04Sequence502004264 (25)gb:AB028616_15180048e-19Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.746008888 (8)gb:AP004326_18402101e-71Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ12
JMFF047P24Sequence566004264 (25)gb:AB028616_15180049e-43Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.150008888 (8)
JMFS008C05Sequence627004264 (25)gb:AB028616_15180046e-41Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMFS009E07Sequence551004264 (25)gb:AB028616_15180043e-28Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMFS013H11Sequence629004264 (25)gb:AB028616_15180049e-40Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMFS019E07Sequence558004264 (25)gb:AB028616_15180042e-28Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMFS021H10Sequence627004264 (25)gb:AB028616_15180043e-28Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMFS033C04Sequence386004264 (25)gb:AB028616_15180045e-30Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMFS040B10Sequence627004264 (25)gb:AB028616_15180042e-37Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMFS044F06Sequence615004264 (25)gb:AB028616_15180042e-28Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMFS060B10Sequence626004264 (25)gb:AB028616_15180048e-41Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMFS072A06Sequence627004264 (25)gb:AB028616_15180041e-39Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMFS094F02Sequence626004264 (25)gb:AB028616_15180041e-38Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMFS096E07Sequence623004264 (25)gb:AB028616_15180046e-38Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMFS118H07Sequence615004264 (25)gb:AB028616_15180049e-34Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMFS123A01Sequence567004264 (25)gb:AB028616_15180042e-28Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMFS124D07Sequence574004264 (25)gb:AB028616_15180043e-31Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMFS141G09Sequence401004264 (25)gb:AB028616_15180043e-21Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMFS154F11Sequence626004264 (25)gb:AB028616_15180041e-41Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMFS157G10Sequence612004264 (25)gb:AB028616_15180043e-27Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMFS158A10Sequence435004264 (25)gb:AB028616_15180043e-28Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMFS163A02Sequence548004264 (25)gb:AB028616_15180042e-52Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMFS167F01Sequence616004264 (25)gb:AB028616_15180049e-23Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.
JMSF011D23Sequence386004264 (25)gb:AB028616_15180049e-15Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.682008888 (8)gb:AP004326_18402101e-79Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ12
JMSF043P17Sequence721004264 (25)gb:AB028616_15180041e-42Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MMG15.546008888 (8)gb:AP004326_18402103e-56Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ12

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS163A02+ AAGGAGATTGTTGGAGAGGTTTAGAAACCAGAGAGAATTTAGCCTTT
                      ____________________________________________________________
consensus AAGGAGATTGTTGGAGAGGTTTAGAAACCAGAGAGAATTTAGCCTTT
 
. : . : . : . : . : . :
JMFS163A02+ GAAGGGACTCCGGGATTGTTCCGGTGAAGAGATTTTCACTCAAATCTAGCCTGCTGAGAT
                      ____________________________________________________________
consensus GAAGGGACTCCGGGATTGTTCCGGTGAAGAGATTTTCACTCAAATCTAGCCTGCTGAGAT
 
. : . : . : . : . : . :
JMFS163A02+ GTGGACACAATCCTAAATCAACTGGAATCTCGCCGGAGAAATGATTGCTTCCTAGAGAAA
                      ____________________________________________________________
consensus GTGGACACAATCCTAAATCAACTGGAATCTCGCCGGAGAAATGATTGCTTCCTAGAGAAA
 
. : . : . : . : . : . :
JMFS163A02+ GCTCTTTTAGGTTGTGTAGGAATGAGGCGCCAATGGGGAGTGACCCAGAAAGCTCATTGT
                      ____________________________________________________________
consensus GCTCTTTTAGGTTGTGTAGGAATGAGGCGCCAATGGGGAGTGACCCAGAAAGCTCATTGT
 
. : . : . : . : . : . :
JMFS163A02+ TTGAAACGTCTAACGTTCTCAGCCTCGTCAACCCCCAAATCCCGCCGGAAAACCTCGGGT
                      ____________________________________________________________
consensus TTGAAACGTCTAACGTTCTCAGCCTCGTCAACCCCCAAATCCCGCCGGAAAACCTCGGGT
 
. : . : . : . : . : . :
JMFS163A02+ CGCCGGAGAAACGGTTGTTGGAAAGGTTAAGGTGGTTCAAAAGCGTGCATTTGGAGAGGC
                      ____________________________________________________________
consensus CGCCGGAGAAACGGTTGTTGGAAAGGTTAAGGTGGTTCAAAAGCGTGCATTTGGAGAGGC
 
. : . : . : . : . : . :
JMFS163A02+ TACTAGGAATCGGACCTTCAAAGGAACTCCCCGCCAAAGACAGGAACCGAAGGGAACCCA
JMFF047P24+ CCGCCAAAGACAGGAACCGAAGGGAACCCA
JMFS072A06+ TCAAAGGAACTCNCCGCCAAAGACAGGAACCGAAGGGAACCCA
JMFS013H11+ AGGGAACCCA
JMFS154F11+ CAGGAACCGAAGGGAACCCA
JMFS060B10+ AACCGAAGGGAACCCA
JMFS008C05+ ACAGGAACCGAAGGGAACCCA
JMSF043P17+ TCAAAGGAACTCCCCGCCAAAGACAGGAACCGAAGGGAACCCA
                      ____________________________________________________________
consensus TACTAGGAATCGGACCTTCAAAGGAACTCCCCGCCAAAGACAGGAACCGAAGGGAACCCA
 
. : . : . : . : . : . :
JMFS163A02+ AATTCTCCAACATGGAATCCGACACAGGCCCCGACAGCGAATTCCCGGAGAGATCGAGGA
JMFS033C04+ AGGCCCCGACAGCGAATTCCCGGAGAGATCGAGGA
JMFF047P24+ AATTCTCCAACATGGAATCCGACACAGGCCCCGACAGCGAATTCCCGGAGAGATCGAGGA
JMFS072A06+ AATTCTCCAACATGGAATCCGACACAGGCCCCGACAGCGAATTCCCGGAGAGATCGAGGA
JMFS013H11+ AATTCTCCAACATGGAATCCGACACAGGCCCCGACAGCGAATTCCCGGAGAGATCGAGGA
JMFS040B10+ ACACAGGCCCCGACAGCGAATTCCCGGAGAGATCGAGGA
JMFS154F11+ AATTCTCCAACATGGAATCCGACACAGGCCCCGACAGCGAATTCCCGGAGAGATCGAGGA
JMFS096E07+ AACATGGAATCCGACACAGGCNCCGACAGCGAATTCCCGGAGAGATCGAGGA
JMFS094F02+ CCAACATGGAATCCGACACAGGCCCCGACAGCGAATTCCCGGAGAGATCGAGGA
JMFS060B10+ AATTCTCCAACATGGAATCCGACACAGGCCCCGACAGCGAATTCCCGGAGAGATCGAGGA
JMFS008C05+ ATTTCTCCAACATGGAATCCGACACAGGCCCCGACAGCGAATTCCCGGAGAGATCGAGGA
JMFS118H07+ AGATCGAGGA
JMSF043P17+ AATTCTCCAACATGGAATCCGACACAGGCCCCGACAGCGAATTCCCGGAGAGATCGAGGA
                      ____________________________________________________________
consensus AATTCTCCAACATGGAATCCGACACAGGCCCCGACAGCGAATTCCCGGAGAGATCGAGGA
 
. : . : . : . : . : . :
JMFS163A02+ ACTGGAGAGAACTCATGTTCCCCAGAGAATCCGGGACGGTACCGGAGATACTGTTCTTAC
JMFS033C04+ ACTGGAGAGAACTCATGTTCCCCAGAGAATCCGGGACGGTACCGGAGATACTGTTCTTAC
JMFF047P24+ ACTGGAGAGAACTCATGTTCCCCAGAGAATCCGGGACGGTACCGGAGATACTGTTCTTAC
JMFS072A06+ ACTGGAGAGAACTCATGTTCCCCAGAGAATCCGGGACGGTACCGGAGATACTGTTCTTAC
JMFS013H11+ ACTGGAGAGAACTCATGTTCCCCAGAGAATCCGGGACGGTACCGGAGATACTGTTCTTAC
JMFS124D07+ ACTCATGTTCCCCAGAGAATCCGGGACGGTACCGGAGATACTGTTCTTAC
JMFS019E07+ GAACTCATGTTCCCCAGAGAATCCGGGACGGTACCGGAGATACTG-TCTTAC
JMFS040B10+ ACTGGAGAGAACTCATGTTCCCCAGAGAATCCGGGACGGTACCGGAGATACTGTTCTTAC
JMFS154F11+ ACTGGAGAGAACTCATGTTCCCCAGAGAATCCGGGACGGTACCGGAGATACTGTTCTTAC
JMFS096E07+ ACTGGAGAGAACTCATGTTCCCCAGAGAATCCGGGACGGTACCGGAGATACTGTTCTTAC
JMFS094F02+ ACTGGAGAGAACTCATGTTCCCCAGAGAATCCGGGACGGTACCGGAGATACTGTTCTTAC
JMFS060B10+ ACTGGAGAGAACTCATGTTCCCCAGAGAATCCGGGACGGTACCGGAGATACTGTTCTTAC
JMFS008C05+ ACTGGAGAGAACTCATGTTCCCCAGAGAATCCGGGACGGTACCGGAGATACTGTTCTTAC
JMFS118H07+ ACTGGAGAGAACTCATGTTCCCCAGAGAATCCGGGACGGTACCGGAGATACTGTTCTTAC
JMSF043P17+ ACTGGAGAGAACTCATGTTCCCCAGAGAATCCGGGACGGTACCGGAGATACTGTTCTTAC
JMFS157G10+ ACGGTACCGGAGATACTGTTCTTAC
JMFS044F06+ GATACTGTTCTTAC
JMFS021H10+ TACCGGAGATACTGTTCTTAC
                      ____________________________________________________________
consensus ACTGGAGAGAACTCATGTTCCCCAGAGAATCCGGGACGGTACCGGAGATACTGTTCTTAC
 
. : . : . : . : . : . :
JMFS163A02+ TAAGATTCAGCGTTTGGAGAT
JMFS033C04+ TAAGATTCAGCGTTTGGAGATTGGTCAAGAGACCCAACTGCGGCGAAATGACGCCGCTGA
JMFF047P24+ TAAGATTCAGCGTTTGGAGATTGGTCAAGAGACCCAACTGCGGCGAAATGACGCCGCTGA
JMFS072A06+ TAAGATTCAGCGTTTGGAGATTGGTCAAGAGACCCAACTGCGGCGAAATGACGCCGCTGA
JMFS013H11+ TAAGATTCAGCGTTTGGAGATTGGTCAAGAGACCCAACTGCGGCGAAATGACGCCGCTGA
JMFS124D07+ TAAGATTCAGCGTTTGGAGATTGGTCAAGAGACCCAACTGCGGCGAAATGACGCCGCTGA
JMFS019E07+ TAAGATTCAGCGTTTGGAGATTGGTCAAGAGACCCAACTGCGGCGAAATGACGCCGCTGA
JMFS040B10+ TAAGATTCAGCGTTTGGAGATTGGTCAAGAGACCCAACTGCGGCGAAATGACGCCGCTGA
JMFS154F11+ TAAGATTCAGCGTTTGGAGATTGGTCAAGAGACCCAACTGCGGCGAAATGACGCCGCTGA
JMFS096E07+ TAAGATTCAGCGTTTGGAGATTGGTCAAGAGACCCAACTGCGGCGAAATGACGCCGCTGA
JMFS094F02+ TAAGATTCAGCGTTTGGAGATTGGTCAAGAGACCCAACTGCGGCGAAATGACGCCGCTGA
JMFS060B10+ TAAGATTCAGCGTTTGGAGATTGGTCAAGAGACCCAACTGCGGCGAAATGACGCCGCTGA
JMFS158A10+ GCGTTTGGAGATTGGTCAAGAGACCCAACTGCGGCGAAATGACGCCGCTGA
JMFS008C05+ TAAGATTCAGCGTTTGGAGATTGGTCAAGAGACCCAACTGCGGCGAAATGACGCCGCTGA
JMFS118H07+ TAAGATTCAGCGTTTGGAGATTGGTCAAGAGACCCAACTGCGGCGAAATGACGCCGCTGA
JMSF043P17+ TAAGATTCAGCGTTTGGAGATTGGTCAAGAGACCCAACTGCGGCGAAATGACGCCGCTGA
JMFS157G10+ TAAGATTCAGCGTTTGGAGATTGGTCAAGAGACCCAACTGCGGCGAAATGACGCCGCTGA
JMFS044F06+ TAAGATTCAGCGTTTGGAGATTGGTCAAGAGACCCAACTGCGGCGAAATGACGCCGCTGA
JMFS123A01+ AGACCCAACTGCGGCGAAATGACGCCGCTGA
JMFS009E07+ ACGCCGCTGA
JMFS021H10+ TAAGATTCAGCGTTTGGAGATTGGTCAAGAGACCCAACTGCGGCGAAATGACGCCGCTGA
JMFS167F01+ CGAAATGACGCCGCTGA
                      ____________________________________________________________
consensus TAAGATTCAGCGTTTGGAGATTGGTCAAGAGACCCAACTGCGGCGAAATGACGCCGCTGA
 
. : . : . : . : . : . :
JMFS033C04+ AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
JMFF047P24+ AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
JMFS072A06+ AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
JMFS013H11+ AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
JMFS124D07+ AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
JMFS019E07+ AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
JMFS040B10+ AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
JMFS154F11+ AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
JMFS096E07+ AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
JMFS094F02+ AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
JMFS060B10+ AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
JMFS158A10+ AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
JMFS008C05+ AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
JMFS118H07+ AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
JMSF043P17+ AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
JMFS157G10+ AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
JMFS044F06+ AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
JMFS123A01+ AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
JMFS141G09+ CCCCCGGCCGA
JMFS009E07+ AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
JMFS021H10+ AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
JMFS167F01+ AGTTG-TGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCNCCGGCCGA
                      ____________________________________________________________
consensus AGTTGTTGGACGCCAATGAAAGAACGTTGAGATGCTCCAACTTCTCGAGCCCCCGGCCGA
 
. : . : . : . : . : . :
JMFS033C04+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMFF047P24+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMFS072A06+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMFS013H11+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMFS124D07+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMFS019E07+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMFS040B10+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMFS154F11+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMFS096E07+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMFS094F02+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMFS060B10+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMFS158A10+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMFS008C05+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMFS118H07+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMSF043P17+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMFS157G10+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMFS044F06+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMFS123A01+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMFS141G09+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMFS009E07+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMFS021H10+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMSF011D23+ GGCGGGGT
JMFF014M04+ TCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
JMFS167F01+ TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
                      ____________________________________________________________
consensus TCTTCCCCGACAAGCCCAATCCATGGAGGTCCACCTCGGAGACTCGGCCGTTGGCGGGGT
 
. : . : . : . : . : . :
JMFS033C04+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFF047P24+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFS072A06+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFS013H11+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFS124D07+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFS019E07+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFS040B10+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFS154F11+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFS096E07+ GGCATTTGACGAAGTTCCATGCACATGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFS094F02+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFS060B10+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFS158A10+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFS008C05+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFS118H07+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMSF043P17+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFS157G10+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFS044F06+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFS123A01+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFS141G09+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFS009E07+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFS021H10+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMSF011D23+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFF014M04+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
JMFS167F01+ GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
                      ____________________________________________________________
consensus GGCATTTGACGAAGTTCCATGCACACGGAGAGTCGTCGTCTTCGCTCCACGTGGCGAGGT
 
. : . : . : . : . : . :
JMFS033C04+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAG-CGATGAGCCCCAAAACATC
JMFF047P24+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMFS072A06+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMFS013H11+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMFS124D07+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMFS019E07+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMFS040B10+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMFS154F11+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMFS096E07+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMFS094F02+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMFS060B10+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMFS158A10+ GAGAAGCCGGGTCTTGGACGCCGCCTTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMFS008C05+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMFS118H07+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMSF043P17+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMFS157G10+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMFS044F06+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMFS123A01+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMFS141G09+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMFS009E07+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMFS021H10+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMSF011D23+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMFF014M04+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
JMFS167F01+ GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
                      ____________________________________________________________
consensus GAGAAGCCGGGTCTTGGACGCCGGATTTGAAGACGATGAGCCCCAAAACATCATCGTTCA
 
. : . : . : . : . : . :
JMFF047P24+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMFS072A06+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMFS013H11+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMFS124D07+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMFS019E07+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMFS040B10+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMFS154F11+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMFS096E07+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMFS094F02+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMFS060B10+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMFS158A10+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMFS008C05+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMFS118H07+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMSF043P17+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMFS157G10+ GGTGCAGCGATGGGGGGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMFS044F06+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMFS123A01+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMFS141G09+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMFS009E07+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMFS021H10+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMSF011D23+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMFF014M04+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
JMFS167F01+ GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
                      ____________________________________________________________
consensus GCTGCAGCGATTCGGCGCCGCCGGCGCCGGAGGTTACACTTAGAACCGACAGAAATACGA
 
. : . : . : . : . : . :
JMFF047P24+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGAT
JMFS072A06+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMFS013H11+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMFS124D07+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMFS019E07+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMFS040B10+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMFS154F11+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMFS096E07+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMFS094F02+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMFS060B10+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMFS158A10+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMFS008C05+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMFS118H07+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMSF043P17+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMFS157G10+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMFS044F06+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMFS123A01+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMFS141G09+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMFS009E07+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMFS021H10+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMSF011D23+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMFF014M04+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
JMFS167F01+ GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
                      ____________________________________________________________
consensus GGAGGAGCATGGAACGGAAACCCATTATGTATATATATAAATTAAAGAGTCTGATAAGGA
 
. : . : . : . : . : . :
JMFS072A06+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAA
JMFS013H11+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
JMFS124D07+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
JMFS019E07+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
JMFS040B10+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
JMFS154F11+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
JMFS096E07+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
JMFS094F02+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
JMFS060B10+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
JMFS158A10+ TTAATAATGGCGGACATACATAAA
JMFS008C05+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
JMFS118H07+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
JMSF043P17+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
JMFS157G10+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
JMFS044F06+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
JMFS123A01+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
JMFS141G09+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
JMFS009E07+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
JMFS021H10+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
JMSF011D23+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
JMFF014M04+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
JMFS167F01+ TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
                      ____________________________________________________________
consensus TTAATAATGGCGGACATACATAAACATGAGATCGAGAAAAGAACGTTGATCTGAATCGAA
 
. : . : . : . : . : . :
JMFS013H11+ GTTCAATGATGAGAGTCCA
JMFS124D07+ GTTCAATGATGAGAGTCCATTGAAGAAGGAAGGAGAGAATGAAG
JMFS019E07+ GTTCAATGATGAGAGTCCATT
JMFS040B10+ GTTCAATGATGAGAGTCCATTGAAGAAGGAAGGAGAGAATGAAGTGAA
JMFS154F11+ GTTCAA
JMFS096E07+ GTTCAATGATGAGAGTCCATTGAAGAAGGAA
JMFS094F02+ GTTCAATGATGAGAGTCCATTGAAGAAGGAAG
JMFS060B10+ GTTCAATGAT
JMFS008C05+ GTTCAA
JMFS118H07+ GTTCAATGATGAGAGTCCATTGAAGAAGGAAGGAGAGAATGAAGTGAACTGTAGTGCTGT
JMSF043P17+ GTTCAATGATGAGAGTCCATTGAAGAAGGAAGGAGAGAATGAAGTGAACTGTAGTGCTGT
JMFS157G10+ GTTCAATGATGAGAGTCCATTGAAGAAGGAAGGAGAGAATGAAGTGAACTGTAGTGCTGT
JMFS044F06+ GTTCAATGATGAGAGTCCATTGAAGAAGGAAGGAGAGAATGAAGTGAACTGTAGTGCTGT
JMFS123A01+ GTTCAATGATGAGAGTCCATTGAAGAAGGAAGGAGAGAATGAAGTGAACTGTAGTGCTGT
JMFS141G09+ GTTCAATGATGAGAGTCCATT-AAGAAGGAA
JMFS009E07+ GTTCAATGATGAGAGTCCATTGAAGAAGGAAGGAGAGAATGAAGTGAACTGTAGTGCTGT
JMFS021H10+ GTTCAATGATGAGAGTCCATTGAAGAAGGAAGGAGAGAATGAAGTGAACTGTAGTGCTGT
JMSF011D23+ GTTCAATGATGAGAGTCCATTGAAGAAGGAAGGAGAGAATGAAGTGAACTGTAGTGCTGT
JMFF014M04+ GTTCAATGATGAGAGTCCATTGAAGAAGGAAGGAGAGAATGAAGTGAACTGTAGTGCTGT
JMFS167F01+ GTTCAATGATGAGAGTCCATTGAAGAAGGAAGGAGAGAATGAAGTGAACTGTAGTGCTGT
                      ____________________________________________________________
consensus GTTCAATGATGAGAGTCCATTGAAGAAGGAAGGAGAGAATGAAGTGAACTGTAGTGCTGT
 
. : . : . : . : . : . :
JMFS118H07+ AGTCA
JMSF043P17+ AGTCACGAGAGAAAGAT
JMFS157G10+ AGTCACGAGAGAAAGATAAAAGATAGATAGACTAGAGACAGAAAATG
JMFS044F06+ AGTCACGAGAGAAAGATAAAAGATAGATAGACTAGAGACAGAAAATGT-AAAGAGAGAGA
JMFS123A01+ AGTCACGAGAGAAAGATAAAAGATAGATAGACTAGAGACAGAAAATGTGAAAGAGA
JMFS009E07+ AGTCACGAGAGAAAGATAAAAGATAGATAGACTAGAGACAGAAAATGTGAAAGAGAG
JMFS021H10+ AGTCACGAGAGAAAGATAAAAGATAGATAGACTAGAGACAGAAAATGTGAAAGAGAGAGA
JMSF011D23+ AGTCACGAGAGAAAGAT
JMFF014M04+ AGTCACGAGAGAAAGATAAAAGATAGATAGACTAGAGACAGAAAATGTGAAAGAGAGAGA
JMFS167F01+ AGTCACGAGAGAAAGATAAAAGATAGATAGACTAGAGACAGAAAATGTGAAAGAGAGAGA
                      ____________________________________________________________
consensus AGTCACGAGAGAAAGATAAAAGATAGATAGACTAGAGACAGAAAATGTGAAAGAGAGAGA
 
. : . : . : . : . : . :
JMFS044F06+ AA
JMFS021H10+ AA
JMFF014M04+ AAGAAAGGAAGAGAGAGAGAGAG
JMFS167F01+ AAGAAAGGAAGAGAGAGAGAGAGAGAGAAGAAAACCGCCGTGGATTTACGGTGGTCCTTA
                      ____________________________________________________________
consensus AAGAAAGGAAGAGAGAGAGAGAGAGAGAAGAAAACCGCCGTGGATTTACGGTGGTCCTTA