Previous Contig 004263:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS138D11Sequence612004263 (2)gb:AY143963_15834203e-54Arabidopsis thaliana At4g18020/T6K21_200 mRNA, complete cds.>gb:AF385725_1794617
JMFS167C04Sequence628004263 (2)gb:AY143963_15834201e-41Arabidopsis thaliana At4g18020/T6K21_200 mRNA, complete cds.>gb:AF385725_1794617

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS138D11+ GCTGTTTTCCCGTATCGTTTCACTAGAGTTCTGAGCATCTGCACCGCTATTTC
                      ____________________________________________________________
consensus GCTGTTTTCCCGTATCGTTTCACTAGAGTTCTGAGCATCTGCACCGCTATTTC
 
. : . : . : . : . : . :
JMFS138D11+ TCGACTCGAGCTGCAACATCGAAACGATGGATTCTTTGACGGGCTTAAGCGACTCAGACA
                      ____________________________________________________________
consensus TCGACTCGAGCTGCAACATCGAAACGATGGATTCTTTGACGGGCTTAAGCGACTCAGACA
 
. : . : . : . : . : . :
JMFS138D11+ CATCCTTTTCCCCTGCATTGAATGCCTTATGAACAACATGCTGCCATATATTCCTCAATT
JMFS167C04+ ACAACATGCTGCCATATATTCCTCAATT
                      ____________________________________________________________
consensus CATCCTTTTCCCCTGCATTGAATGCCTTATGAACAACATGCTGCCATATATTCCTCAATT
 
. : . : . : . : . : . :
JMFS138D11+ TGTCATCTGATAGCGGTTTCTGAAGAAACTCAACTGCACCGAGCGCAATGCACTTCATCA
JMFS167C04+ TGTCATCTGATAGCGGTTTCTGAAGAAACTCAACTGCACCGAGCGCAATGCACTTCATCA
                      ____________________________________________________________
consensus TGTCATCTGATAGCGGTTTCTGAAGAAACTCAACTGCACCGAGCGCAATGCACTTCATCA
 
. : . : . : . : . : . :
JMFS138D11+ TGGTATTAAGGCAGTGGATATTTGAGGTCATTATGGTGGGTAAATCTTTAGCAGTTTCAA
JMFS167C04+ TGGTATTAAGGCAGTGGATATTTGAGGTCATTATGGTGGGTAAATCTTTAGCAGTTTCAA
                      ____________________________________________________________
consensus TGGTATTAAGGCAGTGGATATTTGAGGTCATTATGGTGGGTAAATCTTTAGCAGTTTCAA
 
. : . : . : . : . : . :
JMFS138D11+ GAAATTTGAATGCCTCATCGCTGTTTCCGGTATTGACCTCTACGATTGCAACATGAAACG
JMFS167C04+ GAAATTTGAATGCCTCATCGCTGTTTCCGGTATTGACCTCTACGATTGCAACATGAAACG
                      ____________________________________________________________
consensus GAAATTTGAATGCCTCATCGCTGTTTCCGGTATTGACCTCTACGATTGCAACATGAAACG
 
. : . : . : . : . : . :
JMFS138D11+ CCTCAGATTTGTTTGAGATTGCCAATAAAGCTTCATTCTCTTTTTGGAATGTAGAAACTA
JMFS167C04+ CCTCAGATTTGTTTGAGATTGCCAATAAAGCTTCATTCTCTTTTTGGAATGTAGAAACTA
                      ____________________________________________________________
consensus CCTCAGATTTGTTTGAGATTGCCAATAAAGCTTCATTCTCTTTTTGGAATGTAGAAACTA
 
. : . : . : . : . : . :
JMFS138D11+ TATAGTTCATTTCCTCAAGCTTTGATCTCATCTCAGCAGCAGAATTGGTGTCCTCATCAA
JMFS167C04+ TATAGTTCATTTCCTCAAGCTTTGATCTCATCTCAGCAGCAGAATTGGTGTCCTCATCAA
                      ____________________________________________________________
consensus TATAGTTCATTTCCTCAAGCTTTGATCTCATCTCAGCAGCAGAATTGGTGTCCTCATCAA
 
. : . : . : . : . : . :
JMFS138D11+ GAAGGAGGACCCTAAGGCCCTTAGGGAAATCTTTCCAATCCAATAAATCATTAGCAGTGC
JMFS167C04+ GAAGGAGGACCCTAAGGCCCTTAGGGAAATCTTTCCAATCCAATAAATCATTAGCAGTGC
                      ____________________________________________________________
consensus GAAGGAGGACCCTAAGGCCCTTAGGGAAATCTTTCCAATCCAATAAATCATTAGCAGTGC
 
. : . : . : . : . : . :
JMFS138D11+ AAACCATTGCTGATTGGCATCCTATCCTTCTCAGGCAGCCTTTCCACTCAAAATATGGCC
JMFS167C04+ AAACCATTGCTGATTGGCATCCTATCCTTCTCAGGCAGCCTTTCCACTCAAAATATGGCC
                      ____________________________________________________________
consensus AAACCATTGCTGATTGGCATCCTATCCTTCTCAGGCAGCCTTTCCACTCAAAATATGGCC
 
. : . : . : . : . : . :
JMFS138D11+ ACTTATCAGCATCATCTAA
JMFS167C04+ ACTTATCAGCATCATCTAATCACTCTGATGAATTTCCAAAAAAGAGAGGAGCTTTTGCTC
                      ____________________________________________________________
consensus ACTTATCAGCATCATCTAATCACTCTGATGAATTTCCAAAAAAGAGAGGAGCTTTTGCTC
 
. : . : . : . : . : . :
JMFS167C04+ ACTTAGCTTGATTTCTAGCTTGCACTTAACCTTCTTTAGGGGATGTTGTATCTAGCTGTA
                      ____________________________________________________________
consensus ACTTAGCTTGATTTCTAGCTTGCACTTAACCTTCTTTAGGGGATGTTGTATCTAGCTGTA
 
. : . : . : . : . : . :
JMFS167C04+ CAGAAAGAAACAGATACCAAAGAGAGAGAAATAGGCAGTACATAGACTGTGAAAGAGAGA
                      ____________________________________________________________
consensus CAGAAAGAAACAGATACCAAAGAGAGAGAAATAGGCAGTACATAGACTGTGAAAGAGAGA