Previous Contig 004260:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFN016G11Sequence642004260 (2)gb:AY050408_15621852e-18Arabidopsis thaliana AT4g08170/T12G13_10 mRNA, complete cds.>gb:AY058241_1564366
JMFS167A08Sequence580004260 (2)gb:AY050408_15621852e-25Arabidopsis thaliana AT4g08170/T12G13_10 mRNA, complete cds.>gb:AY058241_1564366

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN016G11+ AAGCTTGCTTTGCTTTGT
                      ____________________________________________________________
consensus AAGCTTGCTTTGCTTTGT
 
. : . : . : . : . : . :
JMFN016G11+ GAATCCACCTACTTAGACAAATACCAAAGAGAGCTAAAATTTGCAGACAAATCCTCCCCC
                      ____________________________________________________________
consensus GAATCCACCTACTTAGACAAATACCAAAGAGAGCTAAAATTTGCAGACAAATCCTCCCCC
 
. : . : . : . : . : . :
JMFN016G11+ CCTTAAGCCAAAAAAAGAATGGGAATGGTAGAAGACAAGAAAAGGGGATAAATGGACAAA
                      ____________________________________________________________
consensus CCTTAAGCCAAAAAAAGAATGGGAATGGTAGAAGACAAGAAAAGGGGATAAATGGACAAA
 
. : . : . : . : . : . :
JMFN016G11+ ACATGAAGAACAGAGCTAGTGAGGAGATCGAACTTGAATATAGGGAACGAAATTCATCGC
                      ____________________________________________________________
consensus ACATGAAGAACAGAGCTAGTGAGGAGATCGAACTTGAATATAGGGAACGAAATTCATCGC
 
. : . : . : . : . : . :
JMFN016G11+ TTCTGAACAAGGATCCATTGGGCCTCTGCAGTGATCAAACGCGCTTCCATTTTGTTTTTT
                      ____________________________________________________________
consensus TTCTGAACAAGGATCCATTGGGCCTCTGCAGTGATCAAACGCGCTTCCATTTTGTTTTTT
 
. : . : . : . : . : . :
JMFN016G11+ CTGCACGTGTTTCGAACCAGCTTCTGAAACTCCCCGCTCTTATGTTAGACGTATACTAGT
                      ____________________________________________________________
consensus CTGCACGTGTTTCGAACCAGCTTCTGAAACTCCCCGCTCTTATGTTAGACGTATACTAGT
 
. : . : . : . : . : . :
JMFN016G11+ GCCCCTGTTGCTTGTAGCGGCCTTGTTGCATTGTCTCTCTCTCGTCGTGCTGCCATCTAT
                      ____________________________________________________________
consensus GCCCCTGTTGCTTGTAGCGGCCTTGTTGCATTGTCTCTCTCTCGTCGTGCTGCCATCTAT
 
. : . : . : . : . : . :
JMFN016G11+ CTTATTCTGGCCAGAACCACCTTACTTACTACTTGTGCTTCACCAGGCTGAGGAGAAAAT
JMFS167A08+ CTTACTTACTACTTGTGCTTCACCAGGCTGAGGAGAAAAT
                      ____________________________________________________________
consensus CTTATTCTGGCCAGAACCACCTTACTTACTACTTGTGCTTCACCAGGCTGAGGAGAAAAT
 
. : . : . : . : . : . :
JMFN016G11+ CCGTAAACACGTGTTCGTATTCTGGCATTTTCCCGTATCCTGGAAAATAATTGATATCTA
JMFS167A08+ CCGTAAACACGTGTTCGTATTCTGGCATTTTCCCGTATCCTGGAAAATAATTGATATCTA
                      ____________________________________________________________
consensus CCGTAAACACGTGTTCGTATTCTGGCATTTTCCCGTATCCTGGAAAATAATTGATATCTA
 
. : . : . : . : . : . :
JMFN016G11+ TAACATAATACCGGTCCTTGGTTCCGTGCTCTCTAATAATATCCAGGTTGAAGAGCCGAA
JMFS167A08+ TAACATAATACCGGTCCTTGGTTCCGTGCTCTCTAATAATATCCAGGTTGAAGAGCCGAA
                      ____________________________________________________________
consensus TAACATAATACCGGTCCTTGGTTCCGTGCTCTCTAATAATATCCAGGTTGAAGAGCCGAA
 
. : . : . : . : . : . :
JMFN016G11+ GGCCC
JMFS167A08+ GGCCCTACATAGAACATAGTAACTTCCAATGTGAGAAAGAAGGAATAAAACGACAACTAA
                      ____________________________________________________________
consensus GGCCCTACATAGAACATAGTAACTTCCAATGTGAGAAAGAAGGAATAAAACGACAACTAA
 
. : . : . : . : . : . :
JMFS167A08+ TTTATCTCCTTCCTCGAACTCTTATGATTAAAACAACAAAAGTAATATCGGAATACCAGT
                      ____________________________________________________________
consensus TTTATCTCCTTCCTCGAACTCTTATGATTAAAACAACAAAAGTAATATCGGAATACCAGT
 
. : . : . : . : . : . :
JMFS167A08+ CGACGACGAAGCTCCCTAGCAAGTCTCTCAAGCAACGGACGTGGAGGGAGTTCAGCAACG
                      ____________________________________________________________
consensus CGACGACGAAGCTCCCTAGCAAGTCTCTCAAGCAACGGACGTGGAGGGAGTTCAGCAACG
 
. : . : . : . : . : . :
JMFS167A08+ CGAGGGTCTAAGTCTGCATCATCTGCGGAGGCAGCTGCACAAGAAACCCTAGGAAAGCGA
                      ____________________________________________________________
consensus CGAGGGTCTAAGTCTGCATCATCTGCGGAGGCAGCTGCACAAGAAACCCTAGGAAAGCGA
 
. : . : . : . : . : . :
JMFS167A08+ AACACACCAGAATTCTTCGATAACTCGCGTCTAGAGACATCAGGTAATGAAAATCGTCTG
                      ____________________________________________________________
consensus AACACACCAGAATTCTTCGATAACTCGCGTCTAGAGACATCAGGTAATGAAAATCGTCTG
 
. : . : . : . : . : . :
JMFS167A08+ ACCACCGTAATTGCTTCCCCGACAATATAAACCTTAAACATGACACCGCCATGGTTGATA
                      ____________________________________________________________
consensus ACCACCGTAATTGCTTCCCCGACAATATAAACCTTAAACATGACACCGCCATGGTTGATA
 
. : . : . : . : . : . :
JMFS167A08+ AATTCTTGCAGCACAAGTGGCGGTTCAAGTATCTGAAGGGAAAGTTCGTCATAGGCCAGT
                      ____________________________________________________________
consensus AATTCTTGCAGCACAAGTGGCGGTTCAAGTATCTGAAGGGAAAGTTCGTCATAGGCCAGT