Previous Contig 004259:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS024E10Sequence614004259 (2)gb:AY133551_15813744e-64Arabidopsis thaliana At1g42440/F7F22_7 mRNA, complete cds.>gb:BT000755_1635027 A
JMFS166G08Sequence574004259 (2)gb:AY133551_15813745e-43Arabidopsis thaliana At1g42440/F7F22_7 mRNA, complete cds.>gb:BT000755_1635027 A

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS024E10+ CTTTTCA
                      ____________________________________________________________
consensus CTTTTCA
 
. : . : . : . : . : . :
JMFS024E10+ ACTCACTAGGTAAATCACGAATGAGCACTGCAGTGCTTGGAAGACCAATAGCTCTAAAGA
                      ____________________________________________________________
consensus ACTCACTAGGTAAATCACGAATGAGCACTGCAGTGCTTGGAAGACCAATAGCTCTAAAGA
 
. : . : . : . : . : . :
JMFS024E10+ CAGAGAGGCAATGATATCCAAATGAATCAATATAATCTTCTTGGCTTGCAGATGCTACAA
                      ____________________________________________________________
consensus CAGAGAGGCAATGATATCCAAATGAATCAATATAATCTTCTTGGCTTGCAGATGCTACAA
 
. : . : . : . : . : . :
JMFS024E10+ AAGCTATCAAATCAGCAACCTTGGCCATTTCCATACATGCCAACAGATCACCATGAGGTG
JMFS166G08+ ATTTCCATACATGCCAACAGATCACCATGAGGTG
                      ____________________________________________________________
consensus AAGCTATCAAATCAGCAACCTTGGCCATTTCCATACATGCCAACAGATCACCATGAGGTG
 
. : . : . : . : . : . :
JMFS024E10+ CTTTCAAGACAGTTGCTCTTAGCTTAAACTCTGAAGAAGCAACTGCTGGAAACCCGGAAG
JMFS166G08+ CTTTCAAGACAGTTGCTCTTAGCTTAAACTCTGAAGAAGCAACTGCTGGAAACCCGGAAG
                      ____________________________________________________________
consensus CTTTCAAGACAGTTGCTCTTAGCTTAAACTCTGAAGAAGCAACTGCTGGAAACCCGGAAG
 
. : . : . : . : . : . :
JMFS024E10+ AAGTGCCTTCGGCGGATAATAATGTCAGAATATCTTGTTCAAGGGAGCAAAGGTCCAGAG
JMFS166G08+ AAGTGCCTTCGGCGGATAATAATGTCAGAATATCTTGTTCAAGGGAGCAAAGGTCCAGAG
                      ____________________________________________________________
consensus AAGTGCCTTCGGCGGATAATAATGTCAGAATATCTTGTTCAAGGGAGCAAAGGTCCAGAG
 
. : . : . : . : . : . :
JMFS024E10+ ATGCAGAAAGACCAAATAGAACAATGACACGTGGAGGAGAATCTGATCCAGACGAGGCTC
JMFS166G08+ ATGCAGAAAGACCAAATAGAACAATGACACGTGGAGGAGAATCTGATCCAGACGAGGCTC
                      ____________________________________________________________
consensus ATGCAGAAAGACCAAATAGAACAATGACACGTGGAGGAGAATCTGATCCAGACGAGGCTC
 
. : . : . : . : . : . :
JMFS024E10+ TTTTCTCCTTCAAAAGAGCTGCCTTCTTTTGCTCCCTTATCATCTTGTTGCGCTGCAGCC
JMFS166G08+ TTTTCTCCTTCAAAAGAGCTGCCTTCTTTTGCTCCCTTATCATCTTGTTGCGCTGCAGCC
                      ____________________________________________________________
consensus TTTTCTCCTTCAAAAGAGCTGCCTTCTTTTGCTCCCTTATCATCTTGTTGCGCTGCAGCC
 
. : . : . : . : . : . :
JMFS024E10+ GAGTCGCCCGTGCTCCCTTGAGGACATTGCGTTCCGCCCTGGCCGATTTGCCTTTATCTT
JMFS166G08+ GAGTCGCCCGTGCTCCCTTGAGGACATTGCGTTCCGCCCTGGCCGATTTGCCTTTATCTT
                      ____________________________________________________________
consensus GAGTCGCCCGTGCTCCCTTGAGGACATTGCGTTCCGCCCTGGCCGATTTGCCTTTATCTT
 
. : . : . : . : . : . :
JMFS024E10+ GGGAAGGGACCTTGTGAACATTGCGAGAAGACTTGGAAGAGAAACGAGTCTTATGCGGCT
JMFS166G08+ GGGAAGGGACCTTGTGAACATTGCGAGAAGACTTGGAAGAGAAACGAGTCTTATGCGGCT
                      ____________________________________________________________
consensus GGGAAGGGACCTTGTGAACATTGCGAGAAGACTTGGAAGAGAAACGAGTCTTATGCGGCT
 
. : . : . : . : . : . :
JMFS024E10+ TGTTCAATTGAGCTCGGCCGCCCATTATTACCGGCTTCTTGTCGTCGCCGCCGCTGCGTA
JMFS166G08+ TGTTCAATTGAGCTCGGCCGCCCATTATTACCGGCTTCTTGTCGTCGCCGCCGCTGCGTA
                      ____________________________________________________________
consensus TGTTCAATTGAGCTCGGCCGCCCATTATTACCGGCTTCTTGTCGTCGCCGCCGCTGCGTA
 
. : . : . : . : . : . :
JMFS024E10+ GAGGCAA
JMFS166G08+ GAGGCAATTTGATGGTAAACCCTTGTCGGCCTGTGGCGGTAGGGTTTATAACCACCAAAT
                      ____________________________________________________________
consensus GAGGCAATTTGATGGTAAACCCTTGTCGGCCTGTGGCGGTAGGGTTTATAACCACCAAAT
 
. : . : . : . : . : . :
JMFS166G08+ AAAACGGTACTCCGTTATAAAATAAACTGAGGAATTGCACCGTAATGAACTCCAAATCTC
                      ____________________________________________________________
consensus AAAACGGTACTCCGTTATAAAATAAACTGAGGAATTGCACCGTAATGAACTCCAAATCTC