Previous Contig 004255:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026L01Sequence609001257 (2)gb:AY088455_15734745e-04Arabidopsis thaliana clone 6790 mRNA, complete sequence.799004255 (5)gb:AY088455_15734742e-63Arabidopsis thaliana clone 6790 mRNA, complete sequence.
JMFF047O07Sequence513001257 (2)gb:AY088455_15734740.005Arabidopsis thaliana clone 6790 mRNA, complete sequence.433004255 (5)gb:AY088455_15734741e-12Arabidopsis thaliana clone 6790 mRNA, complete sequence.
JMFS066E02Sequence627004255 (5)gb:ATAC011623_15433292e-05Arabidopsis thaliana chromosome III BAC F24P17 genomic sequence, complete sequen
JMFS161D05Sequence572004255 (5)gb:AK118837_18167957e-30Arabidopsis thaliana At5g18760 mRNA for unknown protein, complete cds, clone: RA
JMFS166C05Sequence619004255 (5)gb:ATAC011623_15433291e-05Arabidopsis thaliana chromosome III BAC F24P17 genomic sequence, complete sequen

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF047O07- GACTCTTATCCCTAATAATTAATAGTTAATAGGAAAACGTTACATATAC
rJMFF026L01- AGTTAATAGGAAAACGTTACATATAC
                      ____________________________________________________________
consensus GACTCTTATCCCTAATAATTAATAGTTAATAGGAAAACGTTACATATAC
 
. : . : . : . : . : . :
rJMFF047O07- GCAGCCTGCTTCACATTTCATGAAGTTCAAGATACCTCAAAACCATATAACTGGAGGCAG
rJMFF026L01- GCAGCCTGCTTCACATTTCATGAAGTTCAAGATACCTCAAAACCATATAACTGGAGGCAG
                      ____________________________________________________________
consensus GCAGCCTGCTTCACATTTCATGAAGTTCAAGATACCTCAAAACCATATAACTGGAGGCAG
 
. : . : . : . : . : . :
rJMFF047O07- TGAAGTTCAAGAAGAGAAAAACACTGCTACTTTTACACATCCTTGCCCAACCCTCAATAG
rJMFF026L01- TGAAGTTCAAGAAGAGAAAAACACTGCTACTTTTACACATCCTTGCCCAACCCTCAATAG
                      ____________________________________________________________
consensus TGAAGTTCAAGAAGAGAAAAACACTGCTACTTTTACACATCCTTGCCCAACCCTCAATAG
 
. : . : . : . : . : . :
rJMFF047O07- AGGTTACAACTATTAACAATATTGCCAGCTTAATTATCACACGTTGCTAGAGCTTGGGGA
rJMFF026L01- AGGTTACAACTATTAACAATATTGCCAGCTTAATTATCACACGTTGCTAGAGCTTGGGGA
                      ____________________________________________________________
consensus AGGTTACAACTATTAACAATATTGCCAGCTTAATTATCACACGTTGCTAGAGCTTGGGGA
 
. : . : . : . : . : . :
rJMFF047O07- AAGCTGAACTCGCAATGCATAATATCGACTATACATGAACTTGAGACCCATTGCAGCTCC
rJMFF026L01- AAGCTGAACTCGCAATGCATAATATCGACTATACATGAACTTGAGACCCATTGCAGCTCC
                      ____________________________________________________________
consensus AAGCTGAACTCGCAATGCATAATATCGACTATACATGAACTTGAGACCCATTGCAGCTCC
 
. : . : . : . : . : . :
rJMFF047O07- GAAACCCAAAACTGATGACAGCGTTATTGAATAAATGGGTGGTAAATGAAGCATAGAGTA
rJMFF026L01- GAAACCCAAAACTGATGACAGCGTTATTGAATAAATGGGTGGTAAATGAAGCATAGAGTA
                      ____________________________________________________________
consensus GAAACCCAAAACTGATGACAGCGTTATTGAATAAATGGGTGGTAAATGAAGCATAGAGTA
 
. : . : . : . : . : . :
rJMFF047O07- GAAGAGGCAAAGAATCATGGCGACNAGTGCAAATTCTAAAGCTGCGTAGGCCCATATGTA
rJMFF026L01- GAAGAGGCAAAGAATCATGGCGACAAGTGCAAATTCTAAAGCTGCGTAGGCCCATATGTA
                      ____________________________________________________________
consensus GAAGAGGCAAAGAATCATGGCGACAAGTGCAAATTCTAAAGCTGCGTAGGCCCATATGTA
 
. : . : . : . : . : . :
rJMFF047O07- CTGTTTAATTGCTTGGATGACTGC
rJMFF026L01- CTGTTTAATTGCTTGGATGACTGCAAAAATAGATGCCAAAAGACCCAAAGTAAACGAGAA
                      ____________________________________________________________
consensus CTGTTTAATTGCTTGGATGACTGCAAAAATAGATGCCAAAAGACCCAAAGTAAACGAGAA
 
. : . : . : . : . : . :
rJMFF026L01- CGTTATAGCAATCACCAGTGCCTTAGTTTTCATGCCATGGATCAGTAACTTCTCAAGAAA
                      ____________________________________________________________
consensus CGTTATAGCAATCACCAGTGCCTTAGTTTTCATGCCATGGATCAGTAACTTCTCAAGAAA
 
. : . : . : . : . : . :
rJMFF026L01- GAAGAAGTAGCATACTGTACTAACCAAGACAAGCACCACAAAGTCCTGCCAAGCACTTAT
                      ____________________________________________________________
consensus GAAGAAGTAGCATACTGTACTAACCAAGACAAGCACCACAAAGTCCTGCCAAGCACTTAT
 
. : . : . : . : . : . :
rJMFF026L01- TCTTTGTGCGTTCAAAGTTAGCTGATTATGGTCCAGCATAATATTTCCTTGGGTAGTACT
                      ____________________________________________________________
consensus TCTTTGTGCGTTCAAAGTTAGCTGATTATGGTCCAGCATAATATTTCCTTGGGTAGTACT
 
. : . : . : . : . : . :
rJMFF026L01- TGGCACAAAATGCAAAGTTACAGGTAAATTTAGCACTTCCTGCTGACAAACGTCACAATT
JMFS161D05+ GCAAAGTTACGGGTAAGTTTAGCACTTCTTGCCTACACACCTCACAGTC
                      ____________________________________________________________
consensus TGGCACAAAATGCAAAGTTACGGGTAAGTTTAGCACTTCTTGCTTACACACGTCACAGTT
 
. : . : . : . : . : . :
rJMFF026L01- TTTGTTTCCTTTCATGCTAAACCACTTAATTGCACACTCTTCGTGTACAAGTCTGAGGTC
JMFS161D05+ TTTGTTCCCTTTGATGCTAAACCACTTAATCGCACAGTCTTCGTGTACGAGCCTGAGGTC
                      ____________________________________________________________
consensus TTTGTTTCCTTTGATGCTAAACCACTTAATTGCACAGTCTTCGTGTACGAGTCTGAGGTC
 
. : . : . : . : . : . :
rJMFF026L01- ACCTTTGCAGCTGCACTCCATCTTCAG
JMFS161D05+ ACCTTTGCAACCGCACTCCATCTTCAGCGTGTTTTTTTCGCTGCATGCTTCGAGACAAAT
                      ____________________________________________________________
consensus ACCTTTGCAGCTGCACTCCATCTTCAGCGTGTTTTTTTCGCTGCATGCTTCGAGACAAAT
 
. : . : . : . : . : . :
JMFS161D05+ TCGGCAAACAGCTTCCTCTTCAGGAATCTCGTGATCCTCTTCCTCGGGCGCAGGCGTAAT
                      ____________________________________________________________
consensus TCGGCAAACAGCTTCCTCTTCAGGAATCTCGTGATCCTCTTCCTCGGGCGCAGGCGTAAT
 
. : . : . : . : . : . :
JMFS161D05+ TTCATCATCGGTGTTACGGTCTTGCTCTTCGCGGGTGGGAAAAGATGTTGATCTCACAAT
                      ____________________________________________________________
consensus TTCATCATCGGTGTTACGGTCTTGCTCTTCGCGGGTGGGAAAAGATGTTGATCTCACAAT
 
. : . : . : . : . : . :
JMFS161D05+ AACAACGGAAAGCGACCTTGTAACAGCAGCTTGAGACGTGCCAGTTCGCAAAGAATGTGA
JMFS066E02+ ATGTGA
JMFS166C05+ ATGTGA
                      ____________________________________________________________
consensus AACAACGGAAAGCGACCTTGTAACAGCAGCTTGAGACGTGCCAGTTCGCAAAGAATGTGA
 
. : . : . : . : . : . :
JMFS161D05+ TTTCTGCCGTTCACCTACTGTCCTTGCAGAAGTAGGTGTAGGCACAGTAGGGGAGGAGTT
JMFS066E02+ TTTCTGCCGTTCACCTACTGTCCTTGCAGAAGTAGGTGTAGGCACAGTAGGGGAGGAGTT
JMFS166C05+ TTTCTGCCGTTCACCTACTGTCCTTGCAGAAGTAGGTGTAGGCACAGTAGGGGAGGAGTT
                      ____________________________________________________________
consensus TTTCTGCCGTTCACCTACTGTCCTTGCAGAAGTAGGTGTAGGCACAGTAGGGGAGGAGTT
 
. : . : . : . : . : . :
JMFS161D05+ TGAAGCAGGCGTCACAGGCAAAGAAGTACATCTCTTCCAACTCGAAAAAATAGGGCTTTC
JMFS066E02+ TGAAGCAGGCGTCACAGGCAAAGAAGTACATCTCTTCCAACTCGAAAAAATAGGGCTTTC
JMFS166C05+ TGAAGCAGGCGTCACAGGCAAAGAAGTACATCTCTTCCAACTCGAAAAAATAGGGCTTTC
                      ____________________________________________________________
consensus TGAAGCAGGCGTCACAGGCAAAGAAGTACATCTCTTCCAACTCGAAAAAATAGGGCTTTC
 
. : . : . : . : . : . :
JMFS161D05+ TGGAGCTATCTTCGAATCCGGACGAAGAAGGGAGCTCCTTTCACCCTCAGAAGCGCCCGC
JMFS066E02+ TGGAGCTATCTTCGAATCCGGACGAAGAAGGGAGCTCCTTTCACCCTCAGAAGCGCCCGC
JMFS166C05+ TGGAGCTATCTTCGAATCCGGACGAAGAAGGGAGCTCCTTTCACCCTCAGAAGCGCCCGC
                      ____________________________________________________________
consensus TGGAGCTATCTTCGAATCCGGACGAAGAAGGGAGCTCCTTTCACCCTCAGAAGCGCCCGC
 
. : . : . : . : . : . :
JMFS161D05+ AATC
JMFS066E02+ AATCTTCCTCTTGAAGCTCAAACCCCGAAAGAATCCTCCCCCAGTTGGACTCCCATTCGA
JMFS166C05+ AATCTTCCTCTTGAAGCTCAAACCCCGAAAGAATCCTCCCCCAGTTGGACTCCCATTCGA
                      ____________________________________________________________
consensus AATCTTCCTCTTGAAGCTCAAACCCCGAAAGAATCCTCCCCCAGTTGGACTCCCATTCGA
 
. : . : . : . : . : . :
JMFS066E02+ AACCCCCGGAGACTGAACCAAACACTTACTCCGATTGCTGCTCCCAACGCCATTTCTCGG
JMFS166C05+ AACCCCCGGAGACTGAACCAAACACTTACTCCGATTGCTGCTCCCAACGCCATTTCTCGG
                      ____________________________________________________________
consensus AACCCCCGGAGACTGAACCAAACACTTACTCCGATTGCTGCTCCCAACGCCATTTCTCGG
 
. : . : . : . : . : . :
JMFS066E02+ AGGAATTTGAAGCGACAGATCCGGGTGCCTCATAGAATTCACCGCAGCTTTTGCCGATTC
JMFS166C05+ AGGAATTTGAAGCGACAGATCCGGGTGCCTCATAGAATTCACCGCAGCTTTTGCCGATTC
                      ____________________________________________________________
consensus AGGAATTTGAAGCGACAGATCCGGGTGCCTCATAGAATTCACCGCAGCTTTTGCCGATTC
 
. : . : . : . : . : . :
JMFS066E02+ CCTCTTCTGAAAA
JMFS166C05+ CCTCTTCTGAAAACCCGCCTGCGGCGATAACGGAGAAACTGGGCGCGCGTCATCGCCATC
                      ____________________________________________________________
consensus CCTCTTCTGAAAACCCGCCTGCGGCGATAACGGAGAAACTGGGCGCGCGTCATCGCCATC
 
. : . : . : . : . : . :
JMFS166C05+ TGGAGCTGAACTAGAGATTGCGTCTTGTTCGGGGGTTTTGGGGGTCTCCATTACTGTGTA
                      ____________________________________________________________
consensus TGGAGCTGAACTAGAGATTGCGTCTTGTTCGGGGGTTTTGGGGGTCTCCATTACTGTGTA
 
. : . : . : . : . : . :
JMFS166C05+ AAATCAAGAAAACGAATTGAACTGAGAAAAAGGAGCTGGCTTTATTGAGTTTTCTTTGCA
                      ____________________________________________________________
consensus AAATCAAGAAAACGAATTGAACTGAGAAAAAGGAGCTGGCTTTATTGAGTTTTCTTTGCA
 
. : . : . : . : . : . :
JMFS166C05+ AGAGCATACAGACAGAGATAGATATACGAAGGGAGTATATGTATGAGTAGAGGAAACATA
                      ____________________________________________________________
consensus AGAGCATACAGACAGAGATAGATATACGAAGGGAGTATATGTATGAGTAGAGGAAACATA