Previous Contig 004250:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS165G10Sequence604004250 (2)
JMSF044M22Sequence367004250 (2)734013567 (2)gb:AF292397_17837718e-78Arabidopsis thaliana POZ/BTB containing-protein AtPOB1 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS165G10+ TGCCA
                      ____________________________________________________________
consensus TGCCA
 
. : . : . : . : . : . :
JMFS165G10+ TTGATGTGAGCAAAATTCAAAAACCCAAATTTCATGTAAAACTAAGAACGTCCCTAAGTT
                      ____________________________________________________________
consensus TTGATGTGAGCAAAATTCAAAAACCCAAATTTCATGTAAAACTAAGAACGTCCCTAAGTT
 
. : . : . : . : . : . :
JMFS165G10+ ATATAAAATGCCAATGGGAAACAAACATTCAATCTTTGATTTCCAATTTGCAAAATTCAC
                      ____________________________________________________________
consensus ATATAAAATGCCAATGGGAAACAAACATTCAATCTTTGATTTCCAATTTGCAAAATTCAC
 
. : . : . : . : . : . :
JMFS165G10+ ATCACATTGTAAGAAAACACAAATGCATTCAAGAAATTAAAAAGAATTATTAGCCCTAAA
                      ____________________________________________________________
consensus ATCACATTGTAAGAAAACACAAATGCATTCAAGAAATTAAAAAGAATTATTAGCCCTAAA
 
. : . : . : . : . : . :
JMSF044M22+ GATTATCCTTATTGATTTCCTCTCTGCGCCGCTTGCGTT
JMFS165G10+ GAAAGATATGGGAAAACTAACGATTATCCTTATTGATTTCCTCTCTGCGCCGCTTGCGTT
                      ____________________________________________________________
consensus GAAAGATATGGGAAAACTAACGATTATCCTTATTGATTTCCTCTCTGCGCCGCTTGCGTT
 
. : . : . : . : . : . :
JMSF044M22+ TGCGCGCCCAATCCACCACGCTGCTAAAGCTCTCACCCCCAGTTTTGGAGCCGGGCAAGT
JMFS165G10+ TGCGCGCCCAATCCACCACGCTGCTAAAGCTCTCACCCCCAGTTTTGGAGCCGGGCAAGT
                      ____________________________________________________________
consensus TGCGCGCCCAATCCACCACGCTGCTAAAGCTCTCACCCCCAGTTTTGGAGCCGGGCAAGT
 
. : . : . : . : . : . :
JMSF044M22+ CGGGCAGAATCTCAATCCTCAGGGTCCGGTCGGAGAAATTGCTGTCGTTGAAGGCGAAAG
JMFS165G10+ CGGGCAGAATCTCAATCCTCAGGGTCCGGTCGGAGAAATTGCTGTCGTTGAAGGCGAAAG
                      ____________________________________________________________
consensus CGGGCAGAATCTCAATCCTCAGGGTCCGGTCGGAGAAATTGCTGTCGTTGAAGGCGAAAG
 
. : . : . : . : . : . :
JMSF044M22+ CGAAGTTGGCGTCGGAAGCCGACCCACGGTGACTGGAGGGAGAAAAATCGAAGTCCATTA
JMFS165G10+ CGAAGTTGGCGTCGGAAGCCGACCCACGGTGACTGGAGGGAGAAAAATCGAAGTCCATTA
                      ____________________________________________________________
consensus CGAAGTTGGCGTCGGAAGCCGACCCACGGTGACTGGAGGGAGAAAAATCGAAGTCCATTA
 
. : . : . : . : . : . :
JMSF044M22+ TCGGCCGCTGATCAAACAGTTNTCGAGTTTTGATTTTTCATACACGGATAATGACTACAA
JMFS165G10+ TCGGCCGCTGATCAAACAGTT-CCGAGTTTTGATTTTTCATACACGGATAATGACTACAA
                      ____________________________________________________________
consensus TCGGCCGCTGATCAAACAGTTNTCGAGTTTTGATTTTTCATACACGGATAATGACTACAA
 
. : . : . : . : . : . :
JMSF044M22+ AACTTTACACAAAGTACTACAAATGAGGATGAGGAAGAGAACCCAAAGCGGGTATTGGGT
JMFS165G10+ AACTTTACACAAAGTACTACAAATGAGGATGAGGAAGAGAACCCAAAGCGGGTATTGGGT
                      ____________________________________________________________
consensus AACTTTACACAAAGTACTACAAATGAGGATGAGGAAGAGAACCCAAAGCGGGTATTGGGT
 
. : . : . : . : . : . :
JMSF044M22+ TTTCC
JMFS165G10+ TTTCCAGGGATGGGGTGGTTGGCATTCGGATTCCGAGGGTTAGTTCGAAAATGGTTACAA
                      ____________________________________________________________
consensus TTTCCAGGGATGGGGTGGTTGGCATTCGGATTCCGAGGGTTAGTTCGAAAATGGTTACAA