Previous Contig 004246:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008F19Sequence172004246 (5)727010823 (5)gb:AP004704_18436871e-62Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P054
JMFF017P23Sequence172004246 (5)740010823 (5)pir|T45840|T458406e-65GTPase activating-like protein - Arabidopsis thaliana>gb:AC012329_1537569 Arabid
JMFF048I16Sequence344004246 (5)gb:AE014187_9388732e-04Plasmodium falciparum 3D7 chromosome 14 complete sequence.>gb:AE014822_1227949 P191010823 (5)
JMFS165D11Sequence561004246 (5)
JMSF052P17Sequence694004246 (5)gb:AE014187_9388730.002Plasmodium falciparum 3D7 chromosome 14 complete sequence.>gb:AE014822_1227949 P877010823 (5)pir|T45840|T458404e-88GTPase activating-like protein - Arabidopsis thaliana>gb:AC012329_1537569 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF052P17+ CTTGACCATGGTGATTTGAGATGACCCCGATCA
                      ____________________________________________________________
consensus CTTGACCATGGTGATTTGAGATGACCCCGATCA
 
. : . : . : . : . : . :
JMSF052P17+ GAAGAAGAACAGGAAGCCGGTGAGGAAGAGGNTACTACGAAGAGAACCGATCTCAAATGG
                      ____________________________________________________________
consensus GAAGAAGAACAGGAAGCCGGTGAGGAAGAGGNTACTACGAAGAGAACCGATCTCAAATGG
 
. : . : . : . : . : . :
JMSF052P17+ ACCCACGACGTCGATGACGATGACGACGAAGATGAAGACGGCGAGGAGGAATTCGAAGTC
                      ____________________________________________________________
consensus ACCCACGACGTCGATGACGATGACGACGAAGATGAAGACGGCGAGGAGGAATTCGAAGTC
 
. : . : . : . : . : . :
JMSF052P17+ GAAGTCTGACTCCGTTTTAGAGATTTCATCTACTCCTATTATCCCTGTTTCTCACTCTAC
                      ____________________________________________________________
consensus GAAGTCTGACTCCGTTTTAGAGATTTCATCTACTCCTATTATCCCTGTTTCTCACTCTAC
 
. : . : . : . : . : . :
JMSF052P17+ TCAAAAATATCTATCTAATCTACAGATTTCTAGGGTTTCAATGCTCAAACTTCCATCGAA
                      ____________________________________________________________
consensus TCAAAAATATCTATCTAATCTACAGATTTCTAGGGTTTCAATGCTCAAACTTCCATCGAA
 
. : . : . : . : . : . :
JMSF052P17+ AAATTTTAAAAAATAAAAATAAAAAATCCCCCCTTTCTGGTATTTTACCTAGAAGCGTAG
JMFS165D11+ GTATTTTACCTAGAAGCGTAG
                      ____________________________________________________________
consensus AAATTTTAAAAAATAAAAATAAAAAATCCCCCCTTTCTGGTATTTTACCTAGAAGCGTAG
 
. : . : . : . : . : . :
JMSF052P17+ AAGACGGCGGTGGCCAGGGCGAGACCAGCCAAGACCGTGACGGCGACAGCTACAGTAGCA
JMFS165D11+ AAGACGGCGGTGGCCAGGGCGAGACCAGCCAAGACCGTGACGGCGACAGCTACAGTAGCA
                      ____________________________________________________________
consensus AAGACGGCGGTGGCCAGGGCGAGACCAGCCAAGACCGTGACGGCGACAGCTACAGTAGCA
 
. : . : . : . : . : . :
JMSF052P17+ TCGGGAACTCCCGTCTTNTTCCAGAAGCCGCCAGACGCGCCGCCGAAACCGATGATACCT
JMFS165D11+ TCGGGAACTCCCGTCTTCTTCCAGAAGCCGCCAGACGCGCCGCCGAAACCGATGATACCT
                      ____________________________________________________________
consensus TCGGGAACTCCCGTCTTCTTCCAGAAGCCGCCAGACGCGCCGCCGAAACCGATGATACCT
 
. : . : . : . : . : . :
JMSF052P17+ CCTCCGAGCTTACTGATAGCGCCGCCGACAGCCTCGACCAAAGAACCGCCGGAGACGGGC
JMFF048I16+ ACGGGC
JMFS165D11+ CCTCCGAGCTTACTGATAGCGCCGCCGACAGCCTCGACCAAAGAACCGCCGGAGACGGGC
                      ____________________________________________________________
consensus CCTCCGAGCTTACTGATAGCGCCGCCGACAGCCTCGACCAAAGAACCGCCGGAGACGGGC
 
. : . : . : . : . : . :
JMSF052P17+ ATGGAGTCGGAGAGAATAAAAAGGCGATTTTACCCCCGGCGAGCTCAGATTCACCGAACC
JMFF048I16+ ATGGAGTCGGAGAGAATAAAAAGGCGATTTTACCCCCGGCGAGCTCAGATTCACCGAACC
JMFS165D11+ ATGGAGTCGGAGAGAATAAAAAGGCGATTTTACCCCCGGCGAGCTCAGATTCACCGAACC
                      ____________________________________________________________
consensus ATGGAGTCGGAGAGAATAAAAAGGCGATTTTACCCCCGGCGAGCTCAGATTCACCGAACC
 
. : . : . : . : . : . :
JMSF052P17+ AAAGCGAGTAGATTTTCCACCATAACAACCACCTCCACCACCCAGCTGAACAAAAGCAGC
JMFF048I16+ AAAGCGAGTAGATTTTCCACCATAACAACCACCTCCACCACCCAGCTGAACAAAAGCAGC
JMFS165D11+ AAAGCGAGTAGATTTTCCACCATAACAACCACCTCCACCACCCAGCTGAACAAAAGCAGC
                      ____________________________________________________________
consensus AAAGCGAGTAGATTTTCCACCATAACAACCACCTCCACCACCCAGCTGAACAAAAGCAGC
 
. : . : . : . : . : . :
JMSF052P17+ ATTCACTTCAACTGCTTTTCCTTTATTGTTCTGAGGAATCGCTTTTTCTTTTCTTTTCAC
JMFF048I16+ ATTCACTTCAACTGCTTTTCCTTTATTGTTCTGAGGAATCGCTTTTTCTTTTCTTTTCAC
JMFF008F19+ TTTTNTTTTCAC
JMFS165D11+ ATTCACTTCAACTGCTTTTCCTTTATTGTTCTGAGGAATCGCTTTTTCTTTTCTTTTCAC
                      ____________________________________________________________
consensus ATTCACTTCAACTGCTTTTCCTTTATTGTTCTGAGGAATCGCTTTTTCTTTTCTTTTCAC
 
. : . : . : . : . : . :
JMFF048I16+ AA-TTTTTTTTTTGGGTTTTCGCTTTTGTTTTTTACACTCCCATGAGTCTCTTTCTTTGT
JMFF017P23+ TTTTTTTTTTGGGTTTTCGCTTTNGTNTTTTACACTCCCATGAGTCTCTTTCTTTGT
JMFF008F19+ AANTTTTTTTTTTGGGTTTTCGCTTTTGTTTTTTACACTCCCATGAGTCTCTTTCTTTGT
JMFS165D11+ AATTTTTTTTTTTGGGTTTTCGCTTTTGTTTTTTACACTCCCATGAGTCTCTTTCTTTGT
                      ____________________________________________________________
consensus AATTTTTTTTTTTGGGTTTTCGCTTTTGTTTTTTACACTCCCATGAGTCTCTTTCTTTGT
 
. : . : . : . : . : . :
JMFF048I16+ CTCTTCTCTCTAATCACTGTAAATTAGGTGCGCAGTAGAGAGACTGCGTTTGATCTCACT
JMFF017P23+ CTCTTCTCTCTAATCACTGTAAATTAGGTGCGCAGTAGAGAGACTGCGTTTGATCTCACT
JMFF008F19+ CTCTTCTCTCTAATCACTGTAAATTAGGTGCGCAGTAGAGAGACTGCGTTTGATCTCACT
JMFS165D11+ CTCTTCTCTCTAATCACTGTAAATTAGGTGCGCAGTAGAGAGACTGCGTTTGATCTCACT
                      ____________________________________________________________
consensus CTCTTCTCTCTAATCACTGTAAATTAGGTGCGCAGTAGAGAGACTGCGTTTGATCTCACT
 
. : . : . : . : . : . :
JMFF048I16+ CTCTTTCTCTTTCTCTCTCTCTCTCTCTCTCTATAAAGT
JMFF017P23+ CTCTTTCTCTTTCTCTCTCTCTCTCTCTCTCTATAAAGT
JMFF008F19+ CTCTTTCTCTTTCTCTCTCTCTCTCTCTCTCTATAAAGT
JMFS165D11+ CTCTTTCTCTTTCTCTCTCTCTCTCTCTCTCTATAAAGTGTTGTGATCCAGAGACTTGGA
                      ____________________________________________________________
consensus CTCTTTCTCTTTCTCTCTCTCTCTCTCTCTCTATAAAGTGTTGTGATCCAGAGACTTGGA