Previous Contig 004241:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS164G02Sequence626004241 (2)pir|E86378|E863788e-17protein F21J9.10 [imported] - Arabidopsis thaliana>gb:AE005172_891397 Arabidopsi
JMSF006C23Sequence400004241 (2)gb:HCO304427_24052270.020Human coxsackievirus B3 genomic RNA for partial polyprotein (VP1), isolate ITA94

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS164G02+ AGTAAGCATGTACAAGAAAAGTTCAT
                      ____________________________________________________________
consensus AGTAAGCATGTACAAGAAAAGTTCAT
 
. : . : . : . : . : . :
JMFS164G02+ CCATTGGACCAAGAACAGAAATAAAGGTGCCAAATTATCGTAGACCAATTTCATTTGTAA
                      ____________________________________________________________
consensus CCATTGGACCAAGAACAGAAATAAAGGTGCCAAATTATCGTAGACCAATTTCATTTGTAA
 
. : . : . : . : . : . :
JMSF006C23+ CAGCATATTGGCATAATCAATATC
JMFS164G02+ GCGAGTTCCACCTTTGAATCTTGGAATCGAAGTTGCCAGCATATTGGCATAATCAATATC
                      ____________________________________________________________
consensus GCGAGTTCCACCTTTGAATCTTGGAATCGAAGTTGCCAGCATATTGGCATAATCAATATC
 
. : . : . : . : . : . :
JMSF006C23+ GGCTTGAAGGGTCTTAAGAGAATCTTGGTAGGACACAGACTTTGCAAGCTGATAGTAATT
JMFS164G02+ GGCTTGAAGGGTCTTAAGAGAATCTTGGTAGGACACAGACTTTGCAAGCTGATAGTAATT
                      ____________________________________________________________
consensus GGCTTGAAGGGTCTTAAGAGAATCTTGGTAGGACACAGACTTTGCAAGCTGATAGTAATT
 
. : . : . : . : . : . :
JMSF006C23+ CGGGATAATCATCATATTCTTCTCCATTGATCACTCTTAAAAAAACCCAAATTCCGGGGA
JMFS164G02+ CGGGATAATCATCATATTCTTCTCCATTGATCACTCTTAAAAAAACCCAAATTCCGGGGA
                      ____________________________________________________________
consensus CGGGATAATCATCATATTCTTCTCCATTGATCACTCTTAAAAAAACCCAAATTCCGGGGA
 
. : . : . : . : . : . :
JMSF006C23+ ATTTCGCAACTCCTTTTGTTTAGTGAAACAGAAAAAATGAAAGGGGCTCTAGCTCTGAGC
JMFS164G02+ ATTTCGCAACTCCTTTTGTTTAGTGAAACAGAAAAAATGAAAGGGGCTCTAGCTCTGAGC
                      ____________________________________________________________
consensus ATTTCGCAACTCCTTTTGTTTAGTGAAACAGAAAAAATGAAAGGGGCTCTAGCTCTGAGC
 
. : . : . : . : . : . :
JMSF006C23+ CTCTGTATATAGGAGGGGTGGAAAGTCAAAGGAGTCTAAATCATTCTTGAAAAGTCTGAA
JMFS164G02+ CTCTGTATATAGGAGGGGTGGAAAGTCAAAGGAGTCTAAATCATTCTTGAAAAGTCTGAA
                      ____________________________________________________________
consensus CTCTGTATATAGGAGGGGTGGAAAGTCAAAGGAGTCTAAATCATTCTTGAAAAGTCTGAA
 
. : . : . : . : . : . :
JMSF006C23+ TATTATAAATGAAGGGAGAGAAGGGGAGATGAAGATTTGGTCATGGCTGCTCAGTTGGTT
JMFS164G02+ TATTATAAATGAAGGGAGAGAAGGGGAGATGAAGATTTGGTCATGGCTGCTCAGTTGGTT
                      ____________________________________________________________
consensus TATTATAAATGAAGGGAGAGAAGGGGAGATGAAGATTTGGTCATGGCTGCTCAGTTGGTT
 
. : . : . : . : . : . :
JMSF006C23+ GGTCGGTCGCTGTTGTGAAGCTTTCAATTCGTGATTGTAATCTGGATTTTGAGCTTT
JMFS164G02+ GGTCGGTCGCTGTTGTGAAGCTTTCAATTCGTGATTGTAATCTGGATTTTGAGCTTTGAC
                      ____________________________________________________________
consensus GGTCGGTCGCTGTTGTGAAGCTTTCAATTCGTGATTGTAATCTGGATTTTGAGCTTTGAC
 
. : . : . : . : . : . :
JMFS164G02+ TACAATCCGTTGAGCGACCTTGAAGAAGCTCACAGAAGAAAGGGATGCGAAATGTGAAAA
                      ____________________________________________________________
consensus TACAATCCGTTGAGCGACCTTGAAGAAGCTCACAGAAGAAAGGGATGCGAAATGTGAAAA
 
. : . : . : . : . : . :
JMFS164G02+ GTTGAGTCTTGGAGCAGAGAGAGAGAGAGAGAGAGAGAGAGACAGAAAATTAAATTAGCC
                      ____________________________________________________________
consensus GTTGAGTCTTGGAGCAGAGAGAGAGAGAGAGAGAGAGAGAGACAGAAAATTAAATTAGCC