Previous Contig 004223:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS162F02Sequence588004223 (6)gb:AC073178_15410092e-04Arabidopsis thaliana chromosome 1 BAC F10D13 genomic sequence, complete sequence
JMSF003I03Sequence244004223 (6)740010421 (7)pir|T05870|T058701e-46cell division protein pelota - Arabidopsis thaliana>gb:ATCHRIV67_1546646 Arabido
JMSF003L24Sequence296004223 (6)735010421 (7)pir|T05870|T058701e-27cell division protein pelota - Arabidopsis thaliana>gb:ATCHRIV67_1546646 Arabido
JMSF004L24Sequence372004223 (6)338010421 (7)
JMSF044N09Sequence811004223 (6)gb:AC073178_15410093e-04Arabidopsis thaliana chromosome 1 BAC F10D13 genomic sequence, complete sequence674010421 (7)pir|T05870|T058703e-59cell division protein pelota - Arabidopsis thaliana>gb:ATCHRIV67_1546646 Arabido
JMSF051H13Sequence710004223 (6)gb:AC073178_15410093e-04Arabidopsis thaliana chromosome 1 BAC F10D13 genomic sequence, complete sequence754010421 (7)pir|T05870|T058703e-45cell division protein pelota - Arabidopsis thaliana>gb:ATCHRIV67_1546646 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF044N09+ TAAGGTTTTGGGT
                      ____________________________________________________________
consensus TAAGGTTTTGGGT
 
. : . : . : . : . : . :
JMSF044N09+ ATGGTTGTTGTACCACGCCCCACTGCGAACCCCTCAACTCACCAAGAGTGAAACGCTTGA
                      ____________________________________________________________
consensus ATGGTTGTTGTACCACGCCCCACTGCGAACCCCTCAACTCACCAAGAGTGAAACGCTTGA
 
. : . : . : . : . : . :
JMSF044N09+ TAAAAACCCTTCATAAATTCAGTCAGGTGAAGAAGACAAGCCCTATGACTTCGAATTCTG
JMSF051H13+ GAAGACAAGCCCTATGACTTCGAATTCTG
                      ____________________________________________________________
consensus TAAAAACCCTTCATAAATTCAGTCAGGTGAAGAAGACAAGCCCTATGACTTCGAATTCTG
 
. : . : . : . : . : . :
JMSF044N09+ GGAACTGTGTACAGGGAGATATTGCAATTCCCAGATACAAGTATAGGGGAGATATGCATG
JMSF051H13+ GGAACTGTGTACAGGGAGATATTGCAATTCCCAGATACAAGTATAGGGGAGATATGCATG
                      ____________________________________________________________
consensus GGAACTGTGTACAGGGAGATATTGCAATTCCCAGATACAAGTATAGGGGAGATATGCATG
 
. : . : . : . : . : . :
JMSF044N09+ ACAAGCAGCATTACCACATGCTATGAAAAAGTATTATTTGAGGCAGTTTCAGAGAGAGAG
JMSF051H13+ ACAAGCAGCATTACCACATGCTATGAAAAAGTATTATTTGAGGCAGTTTCAGAGAGAGAG
                      ____________________________________________________________
consensus ACAAGCAGCATTACCACATGCTATGAAAAAGTATTATTTGAGGCAGTTTCAGAGAGAGAG
 
. : . : . : . : . : . :
JMSF044N09+ AGAGATCACTAATCTTGAACAACTTCACACACCAAGATTTACTGCTCAGAGTGATGCAAC
JMSF051H13+ AGAGATCACTAATCTTGAACAACTTCACACACCAAGATTTACTGCTCAGAGTGATGCAAC
JMFS162F02+ TCTTGAACAACTTCACACACCAAGATTTACTGCTCAGAGTGATGCAAC
                      ____________________________________________________________
consensus AGAGATCACTAATCTTGAACAACTTCACACACCAAGATTTACTGCTCAGAGTGATGCAAC
 
. : . : . : . : . : . :
JMSF044N09+ CATGTATGTCAATGCCCTCTAAATTAACCAGACTGTCCACACCTGGAAGCTCAATCAAAT
JMSF051H13+ CATGTATGTCAATGCCCTCTAAATTAACCAGACTGTCCACACCTGGAAGCTCAATCAAAT
JMFS162F02+ CATGTATGTCAATGCCCTCTAAATTAACCAGACTGTCCACACCTGGAAGCTCAATCAAAT
                      ____________________________________________________________
consensus CATGTATGTCAATGCCCTCTAAATTAACCAGACTGTCCACACCTGGAAGCTCAATCAAAT
 
. : . : . : . : . : . :
JMSF044N09+ TACTGCACTCATAAAGATACAATTCATGTAGCCTTAATAAGCCAGCGAGGTCGATCTTGT
JMSF051H13+ TACTGCACTCATAAAGATACAATTCATGTAGCCTTAATAAGCCAGCGAGGTCGATCTTGT
JMSF004L24+ GCGAGGTCGATCTTGT
JMFS162F02+ TACTGCACTCATAAAGATACAATTCATGTAGCCTTAATAAGCCAGCGAGGTCGATCTTGT
                      ____________________________________________________________
consensus TACTGCACTCATAAAGATACAATTCATGTAGCCTTAATAAGCCAGCGAGGTCGATCTTGT
 
. : . : . : . : . : . :
JMSF044N09+ ACATTTTCCAGCAATGGAGAATAACGCGTGGACAGTGTCTCTGATTGATTGTGGCAATTC
JMSF051H13+ ACATTTTCCAGCAATGGAGAATAACGCGTGGACAGTGTCTCTGATTGATTGTGGCAATTC
JMSF004L24+ ACATTTTCCAGCAATGGAGAATAACGCGTGGACAGTGTCTCTGATTGATTGTGGCAATTC
JMFS162F02+ ACATTTTCCAGCAATGGAGAATAACGCGTGGACAGTGTCTCTGATTGATTGTGGCAATTC
                      ____________________________________________________________
consensus ACATTTTCCAGCAATGGAGAATAACGCGTGGACAGTGTCTCTGATTGATTGTGGCAATTC
 
. : . : . : . : . : . :
JMSF044N09+ AACCATAGAGAGACAGTGTCTTCAGACTACGAGGTCCAGTAAAGTTTAGGGCTCTAAGCT
JMSF051H13+ AACCATAGAGAGACAGTGTCTTCAGACTACGAGGTCCAGTAAAGTTTAGGGCTCTAAGCT
JMSF004L24+ AACCATAGAGAGACAGTGTCTTCAGACTACGAGGTCCAGTAAAGTTTAGGGCTCTAAGCT
JMSF003L24+ CATAGAGAGACAGTGTCTTCAGACTACGAGGTCCAGTAAAGTTTAGGGCTCTAAGCT
JMSF003I03+ TAAGCT
JMFS162F02+ AACCATAGAGAGACAGTGTCTTCAGACTACGAGGTCCAGTAAAGTTTAGGGCTCTAAGCT
                      ____________________________________________________________
consensus AACCATAGAGAGACAGTGTCTTCAGACTACGAGGTCCAGTAAAGTTTAGGGCTCTAAGCT
 
. : . : . : . : . : . :
JMSF044N09+ TCTTGCAACCAACAAGCTCTATCCAAAATCCTGCAAATTAGGTTGAAATTCTCATTTCTC
JMSF051H13+ TCTTGCAACCAACAAGCTCTATCCAAAATCCTGCAAATTAGGTTGAAATTCTCATTTCTC
JMSF004L24+ TCTTGCAACCAACAAGCTCTATCCAAAATCCTGCAAATTAGGTTGAAATTCTCATTTCTC
JMSF003L24+ TCTTGCAACCAACAAGCTCTATCCAAAATCCTGCAAATTAGGTTGAAATTCTCATTTCTC
JMSF003I03+ TCTTGCAACCAACAAGCTCTATCCAAAATCCTGCAAATTAGGTTGAAATTCTCATTTCTC
JMFS162F02+ TCTTGCAACCAACAAGCTCTATCCAAAATCCTGCAAATTAGGTTGAAATTCTCATTTCTC
                      ____________________________________________________________
consensus TCTTGCAACCAACAAGCTCTATCCAAAATCCTGCAAATTAGGTTGAAATTCTCATTTCTC
 
. : . : . : . : . : . :
JMSF044N09+ AACCGTCGAATCGGAATATTTCGTCTAGGCCGTATCACTCCTCCGGAATTGGTCCTGAGT
JMSF051H13+ AACCGTCGAATCGGAATATTTCGTCTAGGCCGTATCACTCCTCCGGAATTGGTCCTGAGT
JMSF004L24+ AACCGTCGAATCGGAATATTTCGTCTAGGCCGTATCACTCCTCCGGAATTGGTCCTGAGT
JMSF003L24+ AACCGTCGAATCGGAATATTTCGTCTAGGCCGTATCACTCCTCCGGAATTGGTCCTGAGT
JMSF003I03+ AACCGTCGAATCGGAATATTTCGTCTAGGCCGTATCACTCCTCCGGAATTGGTCCTGAGT
JMFS162F02+ AACCGTCGAATCGGAATATTTCGTCTAGGCCGTATCACTCCTCCGGAATTGGTCCTGAGT
                      ____________________________________________________________
consensus AACCGTCGAATCGGAATATTTCGTCTAGGCCGTATCACTCCTCCGGAATTGGTCCTGAGT
 
. : . : . : . : . : . :
JMSF044N09+ GAAAATTGATGATGCTTTCCTATATTTATAATGCTTCACCCCAACGGCTT---CTACACC
JMSF051H13+ GAAAATTGATGATGCTTTCCTCTATTTATAATGCTTCACCCCAAC-GCTTCTCCTACACC
JMSF004L24+ GAAAATTGATGATGCTTTCCTCTATTTATAATGCTTCACCCCAACGGCTTCTCCTACACC
JMSF003L24+ GAAAATTGATGATGCTTTCCTCTATTTATAATGCTTCACCCCAACGGCTTCTCCTACACC
JMSF003I03+ GAAAATTGATGATGCTTTCCTCTATTTATAATGCTTCACCCCAACGGCTTCTCCTACACC
JMFS162F02+ GAAAATTGATGATGCTTTCCTCTATTTATAATGCTTCACCCCAACGGCTTCTCCTACACC
                      ____________________________________________________________
consensus GAAAATTGATGATGCTTTCCTCTATTTATAATGCTTCACCCCAACGGCTTCTCCTACACC
 
. : . : . : . : . : . :
JMSF044N09+ GCCGTCCGAACGCCTACGCTGCTCTGGTTCGCGTCGATTAGCTTTGGGCATTTCTCTTCC
JMSF051H13+ GCCGTCCGAACGCCTACGCTGCTCTGGTTCGCGTCGATTAGCTTTGGGCATTTCTCTTCC
JMSF004L24+ GCCGTCCGAACGCCTACGCTGCTCTGGTTCGCGTCGATTAGCTTTGGGCATTTCTC
JMSF003L24+ GCCGTCCGAACGCCTACGCTGCTCTGGTTCGCGTCGATTAGCTTTGGGCATTTCTCTTC
JMSF003I03+ GCCGTCCGAACGCCTACGCTGCTCTGGTTCGCGTCGATTAGCTTTGGGCATTTCTCT
JMFS162F02+ GCCGTCCGAACGCCTACGCTGCTCTGGTTCGCGTCGATTAGCTTTGGGCATTTCTCTTCC
                      ____________________________________________________________
consensus GCCGTCCGAACGCCTACGCTGCTCTGGTTCGCGTCGATTAGCTTTGGGCATTTCTCTTCC
 
. : . : . : . : . : . :
JMSF044N09+ GATCGACTGCTTCCTTGACT
JMSF051H13+ GATCGACTGCTTCCTTGACT
JMFS162F02+ GATCGACTGCTTCCTTGACTGGCAGAAAAGAGAAACATGGACTTGCAATTTGGGCTGGCC
                      ____________________________________________________________
consensus GATCGACTGCTTCCTTGACTGGCAGAAAAGAGAAACATGGACTTGCAATTTGGGCTGGCC