Previous Contig 004219:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005I22Sequence479004219 (4)gb:AY142616_15830328e-42Arabidopsis thaliana putative ubiquitin-specific protease UBP12 (At5g06600) mRNA758020745gb:AP002543_18226542e-26Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:F15M7.
JMFS109H10Sequence617004219 (4)gb:AY142616_15830324e-77Arabidopsis thaliana putative ubiquitin-specific protease UBP12 (At5g06600) mRNA
JMFS162B05Sequence574004219 (4)gb:AY142616_15830328e-52Arabidopsis thaliana putative ubiquitin-specific protease UBP12 (At5g06600) mRNA
JMSF017P06Sequence498004219 (4)gb:AY142616_15830323e-42Arabidopsis thaliana putative ubiquitin-specific protease UBP12 (At5g06600) mRNA

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS109H10+ GAGTCATATGACCAATAATCAATGACCTTCCTTACAGCAACATCAGCTTCAATTACA
                      ____________________________________________________________
consensus GAGTCATATGACCAATAATCAATGACCTTCCTTACAGCAACATCAGCTTCAATTACA
 
. : . : . : . : . : . :
JMFS109H10+ ACAGTATCGCTCACAAGGTATCCCTTGCCAGGGTCATAAAGCTCACTAAGAAGCATGAAC
                      ____________________________________________________________
consensus ACAGTATCGCTCACAAGGTATCCCTTGCCAGGGTCATAAAGCTCACTAAGAAGCATGAAC
 
. : . : . : . : . : . :
JMFS109H10+ GATGTAAAACCCCAATCACTTTCCCTTTGGTTGAATTGGTGTTGCGTCTCCTTTTTAACA
JMFS162B05+ TTGGTTGAATTGGTGTTGCGTCTCCTTTTTAACA
                      ____________________________________________________________
consensus GATGTAAAACCCCAATCACTTTCCCTTTGGTTGAATTGGTGTTGCGTCTCCTTTTTAACA
 
. : . : . : . : . : . :
JMFS109H10+ GTATACTTGGGATTAATTTGATTCACAACAGCTAAGCTGAACTGGGCATATCTATTCCAC
JMSF017P06+ CAACAGNTAAGCTGAACTGGGCATATCTATTCCAC
JMFF005I22+ CAACAGNTAAGCTGAACTGGGCATATCTATTCCAC
JMFS162B05+ GTATACTTGGGATTAATTTGATTCACAACAGCTAAGCTGAACTGGGCATATCTATTCCAC
                      ____________________________________________________________
consensus GTATACTTGGGATTAATTTGATTCACAACAGCTAAGCTGAACTGGGCATATCTATTCCAC
 
. : . : . : . : . : . :
JMFS109H10+ CCATATGGTAAAGTAGCTGAATCTGCCACATCCAAATACATTGACAAGCATTCCACATTG
JMSF017P06+ CCATATGGTAAAGTAGCTGAATCTGCCACATCCAAATACATTGACAAGCATTCCACATTG
JMFF005I22+ CCATATGGTAAAGTAGCTGAATCTGCCACATCCAAATACATTGACAAGCATTCCACATTG
JMFS162B05+ CCATATGGTAAAGTAGCTGAATCTGCCACATCCAAATACATTGACAAGCATTCCACATTG
                      ____________________________________________________________
consensus CCATATGGTAAAGTAGCTGAATCTGCCACATCCAAATACATTGACAAGCATTCCACATTG
 
. : . : . : . : . : . :
JMFS109H10+ TTTCCTTTTGGAAATATTAGCACCCGCCATTTATAACCACCTACAGTAAAAACCTCTGAG
JMSF017P06+ TTTCCTTTTGGAAATATTAGCACCCGCCATTTATAACCACCTACAGTAAAAACCTCTGAG
JMFF005I22+ TTTCCTTTTGGAAATATTAGCACCCGCCATTTATAACCACCTACAGTAAAAACCTCTGAG
JMFS162B05+ TTTCCTTTTGGAAATATTAGCACCCGCCATTTATAACCACCTACAGTAAAAACCTCTGAG
                      ____________________________________________________________
consensus TTTCCTTTTGGAAATATTAGCACCCGCCATTTATAACCACCTACAGTAAAAACCTCTGAG
 
. : . : . : . : . : . :
JMFS109H10+ TATAGCTTCTTCACATTTAACCTAGAAAAATTTTCAATTGTCCATGTGAAGCGAGAAGCC
JMSF017P06+ TATAGCTTCTTCACATTTAACCTAGAAAAATTTTCAATTGTCCATGTGAAGCGAGAAGCC
JMFF005I22+ TATAGCTTCTTCACATTTAACCTAGAAAAATTTTCAATTGTCCATGTGAAGCGAGAAGCC
JMFS162B05+ TATAGCTTCTTCACATTTAACCTAGAAAAATTTTCAATTGTCCATGTGAAGCGAGAAGCC
                      ____________________________________________________________
consensus TATAGCTTCTTCACATTTAACCTAGAAAAATTTTCAATTGTCCATGTGAAGCGAGAAGCC
 
. : . : . : . : . : . :
JMFS109H10+ TGTGGCTCATCTACTGCTTGGTTTTCCACCGCATTAGCACTCTCTGTTGGTGTAACTTCC
JMSF017P06+ TGTGGCTCATCTACTGCTTGGTTTTCCACCGCATTAGCACTCTCTGTTGGTGTAACTTCC
JMFF005I22+ TGTGGCTCATCTACTGCTTGGTTTTCCACCGCATTAGCACTCTCTGTTGGTGTAACTTCC
JMFS162B05+ TGTGGCTCATCTACTGCTTGGTTTTCCACCGCATTAGCACTCTCTGTTGGTGTAACTTCC
                      ____________________________________________________________
consensus TGTGGCTCATCTACTGCTTGGTTTTCCACCGCATTAGCACTCTCTGTTGGTGTAACTTCC
 
. : . : . : . : . : . :
JMFS109H10+ ATGGGCTGAGGACCTTCCACTAGTGGCTGAGGACCCTCCACTACATCAGAGTGCGGCACA
JMSF017P06+ ATGGGCTGAGGACCTTCCACTAGTGGCTGAGGACCCTCCACTACATCAGAGTGCGGCACA
JMFF005I22+ ATGGGCTGAGGACCTTCCACTAGTGGCTGAGGACCCTCCACTACATCAGAGTGCGGCACA
JMFS162B05+ ATGGGCTGAGGACCTTCCACTAGTGGCTGAGGACCCTCCACTACATCAGAGTGCGGCACA
                      ____________________________________________________________
consensus ATGGGCTGAGGACCTTCCACTAGTGGCTGAGGACCCTCCACTACATCAGAGTGCGGCACA
 
. : . : . : . : . : . :
JMFS109H10+ AGCATCTCCTCTTCCTGCTGATCCAACGGTTGATGATTCAGCATGGTCATAACGGAAGAG
JMSF017P06+ AGCATCTCCTCTTCCTGCTGATCCAACGGTTGATGATTCAGCATGGTCATAACGGAAGAG
JMFF005I22+ AGCATCTCCTCTTCCTGCTGATCCAACGGTTGATGATTCAGCATGGTCATAACGGAAGAG
JMFS162B05+ AGCATCTCCTCTTCCTGCTGATCCAACGGTTGATGATTCAGCATGGTCATAACGGAAGAG
                      ____________________________________________________________
consensus AGCATCTCCTCTTCCTGCTGATCCAACGGTTGATGATTCAGCATGGTCATAACGGAAGAG
 
. : . : . : . : . : . :
JMFS109H10+ AAATTGAGGGTCCGATCAAC
JMSF017P06+ AAATTGAGGGTCCGATCAACAATTGAAAGGGATAGCAAGAGGAGGCTCTCCGGTGAAGAG
JMFF005I22+ AAATTGAGGGTCCGATCAACAATTGAAAGGGATAGCAAGAGGAGGCTCTCCGGTGAAGAG
JMFS162B05+ AAATTGAGGGTCCGATCAACAATTGAAAGGGATAGCAAGAGGAGGCTCTCCGGTGAAGAG
                      ____________________________________________________________
consensus AAATTGAGGGTCCGATCAACAATTGAAAGGGATAGCAAGAGGAGGCTCTCCGGTGAAGAG
 
. : . : . : . : . : . :
JMSF017P06+ AGAAGCGAGTTGAGGTGGAGAGAGAGAAAGAAGACTCT
JMFF005I22+ AGAAGCGAGTTGAGGT
JMFS162B05+ AGAAGCGAGTTGAGGTGGAGAGAGAGAAAGAAGACTCTGGGTTTCTGAGTGTGTCGATGG
                      ____________________________________________________________
consensus AGAAGCGAGTTGAGGTGGAGAGAGAGAAAGAAGACTCTGGGTTTCTGAGTGTGTCGATGG