Previous Contig 004218:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009J01Sequence312004218 (13)
JMFS012E04Sequence620004218 (13)pir|G86342|G863427e-47hypothetical protein F9H16.3 - Arabidopsis thaliana>gb:AE005172_891058 Arabidops
JMFS035C01Sequence603004218 (13)pir|G86342|G863425e-10hypothetical protein F9H16.3 - Arabidopsis thaliana>gb:AE005172_891058 Arabidops
JMFS067H06Sequence617004218 (13)gb:ATH243094_15520884e-40Arabidopsis thaliana SPL1R2 gene for Spl1-Related2 protein, exons 1 to 8.
JMFS085C10Sequence615004218 (13)pir|G86342|G863426e-17hypothetical protein F9H16.3 - Arabidopsis thaliana>gb:AE005172_891058 Arabidops
JMFS087C03Sequence627004218 (13)gb:ATH242957_15520792e-13Arabidopsis thaliana partial mRNA for SPL1-Related2 protein (SPL1R2 gene).
JMFS101G03Sequence615004218 (13)pir|G86342|G863427e-20hypothetical protein F9H16.3 - Arabidopsis thaliana>gb:AE005172_891058 Arabidops
JMFS105B03Sequence622004218 (13)gb:ATH242957_15520795e-14Arabidopsis thaliana partial mRNA for SPL1-Related2 protein (SPL1R2 gene).
JMFS129G05Sequence627004218 (13)pir|G86342|G863427e-24hypothetical protein F9H16.3 - Arabidopsis thaliana>gb:AE005172_891058 Arabidops
JMFS132H08Sequence600004218 (13)pir|G86342|G863421e-13hypothetical protein F9H16.3 - Arabidopsis thaliana>gb:AE005172_891058 Arabidops
JMFS141E06Sequence626004218 (13)pir|G86342|G863422e-61hypothetical protein F9H16.3 - Arabidopsis thaliana>gb:AE005172_891058 Arabidops
JMFS162A10Sequence582004218 (13)pir|G86342|G863426e-07hypothetical protein F9H16.3 - Arabidopsis thaliana>gb:AE005172_891058 Arabidops
JMSF006G15Sequence418004218 (13)pir|G86342|G863427e-12hypothetical protein F9H16.3 - Arabidopsis thaliana>gb:AE005172_891058 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS067H06+ AGAACTACACAACCAGGCCTAATGTGACTCTCCATTTCTGAAGGAATATNT
                      ____________________________________________________________
consensus AGAACTACACAACCAGGCCTAATGTGACTCTCCATTTCTGAAGGAATATNT
 
. : . : . : . : . : . :
JMFS067H06+ GAGAGCCAGTGGTAGATCTGCGTTCGCAGTGACCCAGGCAAGTGACTGGGATCTTTGTCA
                      ____________________________________________________________
consensus GAGAGCCAGTGGTAGATCTGCGTTCGCAGTGACCCAGGCAAGTGACTGGGATCTTTGTCA
 
. : . : . : . : . : . :
JMFS067H06+ AATAGTTTAAACATTATGCGTCCAGTTCGATCCTGAGCATCGGAGTTCAAACTAGCAGGT
                      ____________________________________________________________
consensus AATAGTTTAAACATTATGCGTCCAGTTCGATCCTGAGCATCGGAGTTCAAACTAGCAGGT
 
. : . : . : . : . : . :
JMFS067H06+ GAATGATCAGATCCAGAAGAAGATGTGTAGCCTGTCTGATAAGGAGAACTTTGAATCGAG
JMFS105B03+ ATGTGTAGCCTGTCTGATAAGGAGAACTNTGAATCGAG
                      ____________________________________________________________
consensus GAATGATCAGATCCAGAAGAAGATGTGTAGCCTGTCTGATAAGGAGAACTTTGAATCGAG
 
. : . : . : . : . : . :
JMFS067H06+ TAACTGTCGGCCCCAGTTATTAAGCCTCCAAAAAGCTGAAACGACGTTACACAACCATTT
JMFS105B03+ TAACTGTCGGCCCCAGTTATTAAGCCTCCAAAAAGCTGAAACGACGTTACACAACCATTT
JMFS087C03+ AACTGTCGGCCCCAGTTATTAAGCCTCCAAAAAGCTGAAACGACGTTACACAACCATTT
                      ____________________________________________________________
consensus TAACTGTCGGCCCCAGTTATTAAGCCTCCAAAAAGCTGAAACGACGTTACACAACCATTT
 
. : . : . : . : . : . :
JMFS067H06+ GTTTTAGCTTCCTTAACATTGCTATTCTCCTCCCTGCTGGCAAATATCCTATCAGGGTTC
JMFS105B03+ GTTTTAGCTTCCTTAACATTGCTATTCTCCTCCCTGCTGGCAAATATCCTATCAGGGTTC
JMFS087C03+ GTTTTAGCTTCTTTAACATTGCTATTCTCCTCCCTGCTGGCAAATATCCTATCAGGGTTC
                      ____________________________________________________________
consensus GTTTTAGCTTCCTTAACATTGCTATTCTCCTCCCTGCTGGCAAATATCCTATCAGGGTTC
 
. : . : . : . : . : . :
JMFS067H06+ GTTGATCCTCTAGAGTCCTGCACAGGAAATAGTTTCTGCACAACTGGCGGAGAAGATGAA
JMFS105B03+ GTTGATCCTCTAGAGTCCTGCACAGGAAATAGTTTCTGCACAACTGGCGGAGAAGATGAA
JMFS087C03+ GTTGATCCTCTAGAGTCCTGCACAGGAAATAGTTTCTGCACAACTGGCGGAGAAGATGAA
                      ____________________________________________________________
consensus GTTGATCCTCTAGAGTCCTGCACAGGAAATAGTTTCTGCACAACTGGCGGAGAAGATGAA
 
. : . : . : . : . : . :
JMFS067H06+ GGCGACCTCCCTGCTGAAGGATTACTGCTCTCAGAAGAGAAATACTTCCTGCCAACTGGA
JMFS105B03+ GGCGACCTCCCTGCTGAAGGATTACTGCTCTCAGAAGAGAAATACTTCCTGCCAACTGGA
JMFS087C03+ GGCGACCTCCCTGCTGAAGGATTACTGCTCTCAGAAGAGAAATACTTCCTGCCAACTGGA
                      ____________________________________________________________
consensus GGCGACCTCCCTGCTGAAGGATTACTGCTCTCAGAAGAGAAATACTTCCTGCCAACTGGA
 
. : . : . : . : . : . :
JMFS067H06+ GGTGTGTGTGTGGAAACATCTTCAGCGGGGGAAGTAAAAAGCCGTAGTGGTAAATTATGA
JMFS105B03+ GGTGTGTGTGTGGAAACATCTTCAGAGGGGGAAGTAAAAAGCCGTAGTGGTAAATTATAA
JMFS087C03+ GGTGTGTGTGTGGAAACATCTTCAGCGGGGGAAGTAAAAAGCCGTAGTGGTAAATTATGA
                      ____________________________________________________________
consensus GGTGTGTGTGTGGAAACATCTTCAGCGGGGGAAGTAAAAAGCCGTAGTGGTAAATTATGA
 
. : . : . : . : . : . :
JMFS067H06+ TGAGTCTCTTGAATGTTTGAGTCTAGATCCTCAGGTGATTGGTAACTTGTGCTACTTTTC
JMFS105B03+ TGAGTCTCTTGAATGTTTGAGTCTAGATCCTCAGGTGATTGGTAACTTGTGCTACTTTTC
JMFS087C03+ TGAGTCTCTTGAATGTTTGAGTCTAGATCCTCAGGTGATTGGTAACTTGTGCTACTTTTC
                      ____________________________________________________________
consensus TGAGTCTCTTGAATGTTTGAGTCTAGATCCTCAGGTGATTGGTAACTTGTGCTACTTTTC
 
. : . : . : . : . : . :
JMFS067H06+ TCTCCTCCAACT-ATGAAAGCTCTAAA
JMFS105B03+ TCTCCTCCAACTGATGAAAGCTCTAAAGGTGGCCGTTTTTGGAAATTGATCCGTGTATCA
JMFS087C03+ TCTCCTCCAACTGATGAAAGCTCTAAAGGTGGCCGTTTTTGGAAATTGATCCGTGTATCA
JMFS012E04+ TGTATCA
                      ____________________________________________________________
consensus TCTCCTCCAACTGATGAAAGCTCTAAAGGTGGCCGTTTTTGGAAATTGATCCGTGTATCA
 
. : . : . : . : . : . :
JMFS105B03+ TGTCCAACACACGCTGATTTACTTCTCTCGGAGTCACTCCCTTGGCTGCTTCTTTGGGAC
JMFS087C03+ TGTCCAACACACGCTGATTTACTTCTCTCGGAGTCACTCCCTTGGCTGCTTCTTTGGGAC
JMFS012E04+ TGTCCAACACACGCTGATTTACTTCTCTCGGAGTCACTCCCTTGGCTGCTTCTTTGGGAC
                      ____________________________________________________________
consensus TGTCCAACACACGCTGATTTACTTCTCTCGGAGTCACTCCCTTGGCTGCTTCTTTGGGAC
 
. : . : . : . : . : . :
JMFS105B03+ TGAACATCAACTGCATCAGAAGCAGCACCAGCCGAAGCTGCTGAAAGTGCAGCAAGCAGG
JMFS087C03+ TGAACATCAACTGCATCAGAAGCAGCACCAGCCGAAGCTGCTGAAAGTGCAGCAAGCAGG
JMFS012E04+ TGAACATCAACTGCATCAGAAGCAGCACCAGCCGAAGCTGCTGAAAGTGCAGCAAGCAGG
                      ____________________________________________________________
consensus TGAACATCAACTGCATCAGAAGCAGCACCAGCCGAAGCTGCTGAAAGTGCAGCAAGCAGG
 
. : . : . : . : . : . :
JMFS105B03+ TCCCGAGTTGAAGGAGATGCGGTGTTCTCCCTAGCTTTGCCCGA
JMFS087C03+ TCCCGAGTTGAAGGAGATGCGGTGTTCTCCCTAGCTTTGCCCGATGAGGGTAATTGATTG
JMFS012E04+ TCCCGAGTTGAAGGAGATGCGGTGTTCTCCCTAGCTTTGCCCGATGAGGGTAATTGATTG
JMFS141E06+ TG
                      ____________________________________________________________
consensus TCCCGAGTTGAAGGAGATGCGGTGTTCTCCCTAGCTTTGCCCGATGAGGGTAATTGATTG
 
. : . : . : . : . : . :
JMFS087C03+ GCATTGGTACCATTTAAGCTCCCACTAA
JMFS012E04+ GCATTGGTACCATTTAAGCTCCCACTAATGGGCAATTTGTCAACTACATTAGCTGGCAAG
JMFS141E06+ GCATTGGTACCATTTAAGCTCCCACTAATGGGCAATTTGTCAACTACATTAGCTGGCAAG
                      ____________________________________________________________
consensus GCATTGGTACCATTTAAGCTCCCACTAATGGGCAATTTGTCAACTACATTAGCTGGCAAG
 
. : . : . : . : . : . :
JMFS012E04+ GGTAATGAATTAATTTTACTAAGAGCTTGCATTATCTGGTCTTTATCAGGTAGAGGTGAG
JMFS141E06+ GGTAATGAATTAATTTTACTAAGAGCTTGCATTATCTGGTCTTTATCAGGTAGAGGTGAG
                      ____________________________________________________________
consensus GGTAATGAATTAATTTTACTAAGAGCTTGCATTATCTGGTCTTTATCAGGTAGAGGTGAG
 
. : . : . : . : . : . :
JMFS012E04+ AGGTTAGTGCTCCTTTTCTCATTGTTACCTTGAGCAGAGGCTATAACTGCTAGCAAATTG
JMFS141E06+ AGGTTAGTGCTCCTTTTCTCATTGTTACCTTGAGCAGAGGCTATAACTGCTAGCAAATTG
                      ____________________________________________________________
consensus AGGTTAGTGCTCCTTTTCTCATTGTTACCTTGAGCAGAGGCTATAACTGCTAGCAAATTG
 
. : . : . : . : . : . :
JMFS012E04+ ACAATATCCAAGTCTCGATTCCCAGGAGCATCATTGCTCCCAGGAAGCATTGGCCGCGAT
JMFS141E06+ ACAATATCCAAGTCTCGATTCCCAGGAGCATCATTGCTCCCAGGAAGCATTGGCCGCGAT
                      ____________________________________________________________
consensus ACAATATCCAAGTCTCGATTCCCAGGAGCATCATTGCTCCCAGGAAGCATTGGCCGCGAT
 
. : . : . : . : . : . :
JMFS012E04+ GTTGTCTCCTCAGGCTGAGTTTTTCTCCTCCTCTTGTTATGCCCAGCAAGTCTTCGCCTA
JMFS141E06+ GTTGTCTCCTCAGGCTGAGTTTTTCTCCTCCTCTTGTTATGCCCAGCAAGTCTTCGCCTA
                      ____________________________________________________________
consensus GTTGTCTCCTCAGGCTGAGTTTTTCTCCTCCTCTTGTTATGCCCAGCAAGTCTTCGCCTA
 
. : . : . : . : . : . :
JMFS012E04+ CAGCTTCTCTTACCCTCATCGAATTCCGAAAGCGGGTGGAACCTGCTACACTGCTGGCAA
JMFS141E06+ CAGCTTCTCTTACCCTCATCGAATTCCGAAAGCGGGTGGAACCTGCTACACTGCTGGCAA
                      ____________________________________________________________
consensus CAGCTTCTCTTACCCTCATCGAATTCCGAAAGCGGGTGGAACCTGCTACACTGCTGGCAA
 
. : . : . : . : . : . :
JMFS012E04+ AACCGTTGCATCTGCTTCCCGACCAAAGCTTTGCTTGCTTTACTGTGCACCTCACAGACC
JMFS141E06+ AACCGTTGCATCTGCTTCCCGACCAAAGCTTTGCTTGCTTTACTGTGCACCTCACAGACC
JMFS129G05+ CAGACC
                      ____________________________________________________________
consensus AACCGTTGCATCTGCTTCCCGACCAAAGCTTTGCTTGCTTTACTGTGCACCTCACAGACC
 
. : . : . : . : . : . :
JMFS012E04+ TTATGGCGTCGGT
JMFS141E06+ TTATGGCGTCGGTGGTAGTCCTTAGCATTGGTGAGATTTTCTTTACAGTTATCAACTTGG
JMFS129G05+ TTATGGCGTCGGTGGTAGTCCTTAGCATTGGTGAGATTTTCTTTACAGTTATCAACTTGG
JMFS101G03+ GGTAGTCCTTAGCATTGGTGAGATTTTCTTTACAGTTATCAACTTGG
JMFS085C10+ AGCATTGGTGAGATTTTCTTTACAGTTATCAACTTGG
JMFS132H08+ CAACTTGG
                      ____________________________________________________________
consensus TTATGGCGTCGGTGGTAGTCCTTAGCATTGGTGAGATTTTCTTTACAGTTATCAACTTGG
 
. : . : . : . : . : . :
JMFS141E06+ CACATAGGATAGTTAGAGGTGTTAGGAGATCCAGATCGGACTCGTTTACTGGGACGCGAC
JMFS129G05+ CACATAGGATAGTTAGAGGTGTTAGGAGATCCAGATCGGACTCGTTTACTGGGACGCGAC
JMSF006G15+ CACATAGGATAGTTAGAGGTGTTAGGAGATCCAGATCGGACTCGTTTACTGGGACGCGAC
JMFS101G03+ CACATAGGATAGTTAGAGGTGTTAGGAGATCCAGATCGGACTCGTTTACTGGGACGCGAC
JMFS085C10+ CACATAGGATAGTTAGAGGTGTTAGGAGATCCAGATCGGACTCGTTTACTGGGACGCGAC
JMFS132H08+ CACATAGGATAGTTAGAGGTGTTAGGAGATCCAGATCGGACTCGTTTACTGGGACGCGAC
JMFS035C01+ GTTAGGAGATCCAGATCGGACTCGTTTACTGGGACGCGAC
                      ____________________________________________________________
consensus CACATAGGATAGTTAGAGGTGTTAGGAGATCCAGATCGGACTCGTTTACTGGGACGCGAC
 
. : . : . : . : . : . :
JMFS141E06+ AGCGCCTCTTCTGCCGAATTCAACACGCAACCGCCAAGGTTGAGCGTAAGAGTCTCATCA
JMFS129G05+ AGCGCCTCTTCTGCCGAATTCAACACGCAACCGCCAAGGTTGAGCGTAAGAGTCTCATCA
JMSF006G15+ AGCGCCTCTTCTGCCGAATTCAACACGCAACCGCCAAGGTTGAGCGTAAGAGTCTCATCA
JMFS101G03+ AGCGCCTCTTCTGCCGAATTCAACACGCAACCGCCAAGGTTGAGCGTAAGAGTCTCATCA
JMFS085C10+ AGCGCCTCTTCTGCCGAATTCAACACGCAACCGCCAAGGTTGAGCGTAAGAGTCTCATCA
JMFS132H08+ AGCGCCTCTTCTGCCGAATTCAACACGCAACCGCCAAGGTTGAGCGTAAGAGTCTCATCA
JMFS035C01+ AGCGCCTCTTCTGCCGAATTCAACACGCAACCGCCAAGGTTGAGCGTAAGAGTCTCATCA
JMFS162A10+ TTCAACACGCAACCGCCAAGGTTGAGCGTAAGAGTCTCATCA
                      ____________________________________________________________
consensus AGCGCCTCTTCTGCCGAATTCAACACGCAACCGCCAAGGTTGAGCGTAAGAGTCTCATCA
 
. : . : . : . : . : . :
JMFS141E06+ TCTTCCACGACACAGATAGGCTTG
JMFS129G05+ TCTTCCACGACACAGATAGGCTTGTCGTTAAAGCTTTGTTCTTTCAACTGTTCCTGGCTT
JMSF006G15+ TCTTCCACGACACAGATAGGCTTGTCGTTAAAGCTTTGTTCTTTCAACTGTTCCTGGCTT
JMFS101G03+ TCTTCCACGACACAGATAGGCTTGTCGTTAAAGCTTTGTTCTTTCAACTGTTCCTGGCTT
JMFS085C10+ TCTTCCACGACACAGATAGGCTTGTCGTTAAAGCTTTGTTCTTTCAACTGTTCCTGGCTT
JMFS132H08+ TCTTCCACGACACAGATAGGCTTGTCGTTAAAGCTTTGTTCTTTCAACTGTTCCTGGCTT
JMFS035C01+ TCTTCCACGACACAGATAGGCTTGTCGTTAAAGCTTTGTTCTTTCAACTGTTCCTGGCTT
JMFS162A10+ TCTTCCACGACACAGATAGGCTTGTCGTTAAAGCTTTGTTCTTTCAACTGTTCCTGGCTT
                      ____________________________________________________________
consensus TCTTCCACGACACAGATAGGCTTGTCGTTAAAGCTTTGTTCTTTCAACTGTTCCTGGCTT
 
. : . : . : . : . : . :
JMFS129G05+ CTCCTCTGCAATTCCGGCCGCGGCGCATCAGATTCTACCGGTTTGGCCACAAACCTGGCG
JMSF006G15+ CTCCTCTGCAATTCCGGCCGCGGCGCATCAGATTCTACCGGTTTGGCCACAAACCTGGCG
JMFS101G03+ CTCCTCTGCAATTCCGGCCGCGGCGCATCAGATTCTACCGGTTTGGCCACAAACCTGGCG
JMFS085C10+ CTCCTCTGCAATTCCGGCCGCGGCGCATCAGATTCTACCGGTTTGGCCACAAACCTGGCG
JMFS132H08+ CTCCTCTGCAATTCCGGCCGCGGCGCATCAGATTCTACCGGTTTGGCCACAAACCTGGCG
JMFS035C01+ CTCCTCTGCAATTCCGGCCGCGGCGCATCAGATTCTACCGGTTTGGCCACAAACCTGGCG
JMFS162A10+ CTCCTCTGCAATTCCGGCCGCGGCGCATCAGATTCTACCGGTTTGGCCACAAACCTGGCG
                      ____________________________________________________________
consensus CTCCTCTGCAATTCCGGCCGCGGCGCATCAGATTCTACCGGTTTGGCCACAAACCTGGCG
 
. : . : . : . : . : . :
JMFS129G05+ CTATCCCATTCCCAAGCTCTGGGATTCCATGAATCCCGCTTCTGCGTAGGCTGAAACGAA
JMSF006G15+ CTATCCCATTCCCAAGCTCTGGGATTCCATGAATCCCGCTTCTGCGTAGGCTGAAACGAA
JMFS101G03+ CTATCCCATTCCCAAGCTCTGGGATTCCATGAATCCCGCTTCTGCGTAGGCTGAAACGAA
JMFS085C10+ CTATCCCATTCCCAAGCTCTGGGATTCCATGAATCCGGCTTCTGCGTAGGCTGAAACGAA
JMFS132H08+ CTATCCCATTCCCAAGCTCTGGGATTCCATGAATCCCGCTTCTGCGTAGGCTGAAACGAA
JMFS035C01+ CTATCCCATTCCCAAGCTCTGGGATTCCATGAATCCCGCTTCTGCGTAGGCTGAAACGAA
JMFS162A10+ CTATCCCATTCCCAAGCTCTGGGATTCCATGAATCCCGCTTCTGCGTAGGCTGAAACGAA
                      ____________________________________________________________
consensus CTATCCCATTCCCAAGCTCTGGGATTCCATGAATCCCGCTTCTGCGTAGGCTGAAACGAA
 
. : . : . : . : . : . :
JMFS129G05+ AGACCGCGTTTTTTCGCAACAGAACGAGGGTCACACAACCCACCGGCAAGTGATTGATGG
JMSF006G15+ AGACCGCGTTTTTTCGCAACAGAACGAGGGTCACACAACCCACCGGCAAGTGATTGATGG
JMFS101G03+ AGACCGCGTTTTTTCGCAACAGAACGAGGGTCACACAACCCACCGGCAAGTGATTGATGG
JMFS085C10+ AGACCGCGTTTTTTCGCAACAGAACGAGGGTCACACAACCCACCGGCAAGTGATTGATGG
JMFS132H08+ AGACCGCGTTTTTTCGCAACAGAACGAGGGTCACACAACCCACCGGCAAGTGATTGATGG
JMFS035C01+ AGACCGCGTTTTTTCGCAACAGAACGAGGGTCACACAACCCACCGGCAAGTGATTGATGG
JMFF009J01+ CGCAACAGAACGAGGGTCACACAACCCACCGGCAAGTGATTGATGG
JMFS162A10+ AGACCGCGTTTTTTCGCAACAGAACGAGGGTCACACAACCCACCGGCAAGTGATTGATGG
                      ____________________________________________________________
consensus AGACCGCGTTTTTTCGCAACAGAACGAGGGTCACACAACCCACCGGCAAGTGATTGATGG
 
. : . : . : . : . : . :
JMFS129G05+ TGAATCATGATTGGGGAAGCTACTCTTCCACTCAAATCCTCCATCTCTATAAATCCCTAA
JMSF006G15+ TGAATCATGATTGGGGAAGCTACTCTTCCACTCAAATCCTCCATCTCTATAAATCC
JMFS101G03+ TGAATCATGATTGGGGAAGCTACTCTTCCACTCAAATCCTCCATCTCTATAAATCCCTAA
JMFS085C10+ TGAATCATGATTGGGGAAGCTACTCTTCCACTCAAATCCTCCATCTCTATAAATCCCTAA
JMFS132H08+ TGAATCATGATTGGGGAAGCTACTCTTCCACTCAAATCCTCCATCTCTATAAATCCCTAA
JMFS035C01+ TGAATCATGATTGGGGAAGCTACTCTTCCACTCAAATCCTCCATCTCTATAAATCCCTAA
JMFF009J01+ TGAATCATGATTGGGGAAGCTACTCTTCCACTCAAATCCTCCATCTCTATAAATCCNTAA
JMFS162A10+ TGAATCATGATTGGGGAAGCTACTCTTCCACTCAAATCCTCCATCTCTATAAATCCCTAA
                      ____________________________________________________________
consensus TGAATCATGATTGGGGAAGCTACTCTTCCACTCAAATCCTCCATCTCTATAAATCCCTAA
 
. : . : . : . : . : . :
JMFS129G05+ GATCTTACATCACTACAAGGATCAAAAACCCTGAGGAGGAATTCATCTCAAGATCTTTAC
JMFS101G03+ GATCTTACATCACTACAAGGATCAAAAACCCTGAGGAGGAATTCATCTCAAGATCTTTAC
JMFS085C10+ GATCTTACATCACTACAAGGATCAAAAACCCTGAGGAGGAATTCATCTCAAGATCTTTAC
JMFS132H08+ GATCTTACATCACTACAAGGATCAAAAACCCTGAGGAGGAATTCATCTCAAGATCTTTAC
JMFS035C01+ GATCTTACATCACTACAAGGATCAAAAACCCTGAGGAGGAATTCATCTCAAGATCTTTAC
JMFF009J01+ GATCTTACATCACTACAAGGATCAAAAACCCTGAGGAGGAATTCATCTCAAGATCTTTAC
JMFS162A10+ GATCTTACATCACTACAAGGATCAAAAACCCTGAGGAGGAATTCATCTCAAGATCTTTAC
                      ____________________________________________________________
consensus GATCTTACATCACTACAAGGATCAAAAACCCTGAGGAGGAATTCATCTCAAGATCTTTAC
 
. : . : . : . : . : . :
JMFS129G05+ TTCTTCAAACTCATCCACTGCGGAAAACTCCAAAGATCCAAGTCTAGGCGACAAAGCAAA
JMFS101G03+ TTCTTCAAACTCATCCACTGCGGAAAACTCCAAAGATCCAAGTCTAGGCGACAAAGCAAA
JMFS085C10+ TTCTTCAAACTCATCCACTGCGGAAAACTCCAAAGATCCAAGTCTAGGCGACAAAGCAAA
JMFS132H08+ TTCTTCAAACTCATCCACTGCGGAAAACTCCAAAGATCCAAGTCTAGGCGACAAAGCAAA
JMFS035C01+ TTCTTCAAACTCATCCACTGCGGAAAACTCCAAAGATCCAAGTCTAGGCGACAAAGCAAA
JMFF009J01+ TTNTTCAAACTCATCCACTGCGGAAAACTCCAAAGATCCAAGTCTAGGCGACAAAGCAAA
JMFS162A10+ TTCTTCAAACTCATCCACTGCGGAAAACTCCAAAGATCCAAGTCTAGGCGACAAAGCAAA
                      ____________________________________________________________
consensus TTCTTCAAACTCATCCACTGCGGAAAACTCCAAAGATCCAAGTCTAGGCGACAAAGCAAA
 
. : . : . : . : . : . :
JMFS129G05+ GAGATCTGAAAGAGAAAGAAA
JMFS101G03+ GAGATCTGAAAGAGAAAGAAAGGTCAAG
JMFS085C10+ GAGATCTGAAAGAGAAAGAAAGGTCAAGGTCCCCTGTA
JMFS132H08+ GAGATCTGAAAGAGAAAGAAAGGTCAAGGTCCCCTGTAGCTAACTTTTCTGT
JMFS035C01+ GAGATCTGAAAGAGAAAGAAAGGTCAAGGTCCCCTGTAGCTAACTTTTCTGTGTTCTCAT
JMFF009J01+ GAGATCTGAAAGAGAAAGAAAGGTCAAGGTCCCCTGTAGCTAACTTTTCTGTGTTCTCAT
JMFS162A10+ GAGATCTGAAAGAGAAAGAAAGGTCAAGGTCCCCTGTAGCTAACTTTTCTGTGTTCTCAT
                      ____________________________________________________________
consensus GAGATCTGAAAGAGAAAGAAAGGTCAAGGTCCCCTGTAGCTAACTTTTCTGTGTTCTCAT
 
. : . : . : . : . : . :
JMFS035C01+ TTCATTTGATGAACAAAC
JMFF009J01+ TTCATTTGATGAACAAAC
JMFS162A10+ TTCATTTGATGAACAAACTCTTCTTTTCTTCTCTTTTCTTTATTTAATTTTTTAGTTAAT
                      ____________________________________________________________
consensus TTCATTTGATGAACAAACTCTTCTTTTCTTCTCTTTTCTTTATTTAATTTTTTAGTTAAT