Previous Contig 004201:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006C17Sequence576004201 (12)pir|G96563|G96563e-112probable coatomer complex subunit, 33791-27676 [imported] - Arabidopsis thaliana773008417 (2)gb:BT006480_16393671e-35Arabidopsis thaliana At1g52360 gene, complete cds.>gb:AK118389_1816368 Arabidops
JMFS021C04Sequence608004201 (12)pir|G96563|G965633e-71probable coatomer complex subunit, 33791-27676 [imported] - Arabidopsis thaliana
JMFS032C04Sequence524004201 (12)pir|G96563|G965639e-59probable coatomer complex subunit, 33791-27676 [imported] - Arabidopsis thaliana
JMFS084F02Sequence616004201 (12)pir|G96563|G965637e-65probable coatomer complex subunit, 33791-27676 [imported] - Arabidopsis thaliana
JMFS089E09Sequence620004201 (12)pir|G96563|G965632e-67probable coatomer complex subunit, 33791-27676 [imported] - Arabidopsis thaliana
JMFS104B05Sequence613004201 (12)pir|G96563|G965632e-63probable coatomer complex subunit, 33791-27676 [imported] - Arabidopsis thaliana
JMFS109A09Sequence626004201 (12)pir|G96563|G965639e-72probable coatomer complex subunit, 33791-27676 [imported] - Arabidopsis thaliana
JMFS110D05Sequence425004201 (12)pir|G96563|G965632e-33probable coatomer complex subunit, 33791-27676 [imported] - Arabidopsis thaliana
JMFS116C11Sequence226004201 (12)
JMFS160D10Sequence618004201 (12)pir|G96563|G965632e-53probable coatomer complex subunit, 33791-27676 [imported] - Arabidopsis thaliana
JMFS160G10Sequence598004201 (12)pir|G96563|G96563e-116probable coatomer complex subunit, 33791-27676 [imported] - Arabidopsis thaliana
JMFS165F12Sequence598004201 (12)pir|G96563|G965632e-64probable coatomer complex subunit, 33791-27676 [imported] - Arabidopsis thaliana

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF006C17+ TTGAAGCTTTCATGTAACCAACTGCCCAGACCCGCTCAAGGCCATAATT
                      ____________________________________________________________
consensus TTGAAGCTTTCATGTAACCAACTGCCCAGACCCGCTCAAGGCCATAATT
 
. : . : . : . : . : . :
JMFF006C17+ CAAAGTGTTTTCAAGTCTATAAGTTGTTGCATGCCATATGCGAACAGTACCATCTTCAGA
JMFS160G10+ A
                      ____________________________________________________________
consensus CAAAGTGTTTTCAAGTCTATAAGTTGTTGCATGCCATATGCGAACAGTACCATCTTCAGA
 
. : . : . : . : . : . :
JMFF006C17+ ACCCGTGATTATAATAGGCAGTTCAGGATGAAAACACACAGCAGAGACATTATGTGTGTG
JMFS160G10+ ACCCGTGATTATAATAGGCAGTTCAGGATGAAAACACACAGCAGAGACATTATGTGTGTG
                      ____________________________________________________________
consensus ACCCGTGATTATAATAGGCAGTTCAGGATGAAAACACACAGCAGAGACATTATGTGTGTG
 
. : . : . : . : . : . :
JMFF006C17+ CCCTTCTAGAGTTTGCACACAACTTTTCGTCTGGTAGTCCCACACCTTTGCAGTGTGATC
JMFS160G10+ CCCTTCTAGAGTTTGCACACAACTTTTCGTCTGGTAGTCCCACACCTTTGCAGTGTGATC
                      ____________________________________________________________
consensus CCCTTCTAGAGTTTGCACACAACTTTTCGTCTGGTAGTCCCACACCTTTGCAGTGTGATC
 
. : . : . : . : . : . :
JMFF006C17+ ATCAGACCCAGTGATTAAGTAAGGTTTATCACCACCTGTGAAATAATCTACACAATTCAC
JMFS160G10+ ATCAGACCCAGTGATTAAGTAAGGTTTATCACCACCTGTGAAATAATCTACACAATTCAC
                      ____________________________________________________________
consensus ATCAGACCCAGTGATTAAGTAAGGTTTATCACCACCTGTGAAATAATCTACACAATTCAC
 
. : . : . : . : . : . :
JMFF006C17+ ACCTTTCAGATGGGCATCCAGCGTGAAGTTTGGATCAGGTGAGCCAAGATTCCAAATCTT
JMFS160G10+ ACCTTTCAGATGGGCATCCAGCGTGAAGTTTGGATCAGGTGAGCCAAGATTCCAAATCTT
                      ____________________________________________________________
consensus ACCTTTCAGATGGGCATCCAGCGTGAAGTTTGGATCAGGTGAGCCAAGATTCCAAATCTT
 
. : . : . : . : . : . :
JMFF006C17+ TATAGTTCGATCAAGAGATGCACTAGCAAAAGTGTTGGTATCTTTTGGATTAAATGTCAC
JMFS160G10+ TATAGTTCGATCAAGAGATGCACTAGCAAAAGTGTTGGTATCTTTTGGATTAAATGTCAC
                      ____________________________________________________________
consensus TATAGTTCGATCAAGAGATGCACTAGCAAAAGTGTTGGTATCTTTTGGATTAAATGTCAC
 
. : . : . : . : . : . :
JMFF006C17+ TTGCATCACATAATGGGAATGGCCCTCAAAAATTTGAGTGCACACCCATCCTTTCTCCCA
JMFS160G10+ TTGCATCACATAATGGGAATGGCCCTCAAAAATTTGAGTGCACACCCATCCTTTCTCCCA
JMFS021C04+ CACACCCATCCTTTCTCCCA
JMFS109A09+ CACACCCATCCTTTCTCCCA
JMFS089E09+ TCCCA
                      ____________________________________________________________
consensus TTGCATCACATAATGGGAATGGCCCTCAAAAATTTGAGTGCACACCCATCCTTTCTCCCA
 
. : . : . : . : . : . :
JMFF006C17+ ATCCCAGAGCTTTATCAGCATGTCATCAGATGATGACAGCACATAAGGAAGAGTAGGATG
JMFS160G10+ ATCCCAGAGCTTTATCAGCATGTCATCAGATGATGACAGCACATAAGGAAGAGTAGGATG
JMFS032C04+ ATAAGGAAGAGTAGGATG
JMFS021C04+ ATCCCAGAGCTTTATCAGCATGTCATCAGATGATGACAGCACATAAGGAAGAGTAGGATG
JMFS109A09+ ATCCCAGAGCTTTATCAGCATGTCATCAGATGATGNCAGCACATAAGGAAGAGTAGGATG
JMFS089E09+ ATCCCAGAGCTTANTCAGCATGTCATCAGATGATGACAGCACATAAGGAAGAGTAGGATG
JMFS165F12+ AGCTTTATCAGCATGTCATCAGATGATGACAGCACATAAGGAAGAGTAGGATG
JMFS084F02+ GAGCTTTATCAGCATGTCATCAGATGATGACAGCACATAAGGAAGAGTAGGATG
JMFS104B05+ CAGCATGTCATCAGATGATGACAGCACATAAGGAAGAGTAGGATG
JMFS160D10+ ATAAGGAAGAGTAGGATG
                      ____________________________________________________________
consensus ATCCCAGAGCTTTATCAGCATGTCATCAGATGATGACAGCACATAAGGAAGAGTAGGATG
 
. : . : . : . : . : . :
JMFF006C17+ AACAGCAACACA-CCTGATATAATCTGTGTGAGCTTCAAAGACTTTAA
JMFS160G10+ AACAGCAACACA-CCTGATATAATCTGTGTGAGCTTCAAAGACTTTAACCTTATCCATGG
JMFS032C04+ AACAGCAACACA-CCTGATATAATCTGTGTGAGCTTCAAAGACTTTAACCTTATCCATGG
JMFS021C04+ AACAGCAACACA-CCTGATATAATCTGTGTGAGCTTCAAAGACTTTAACCTTATCCATGG
JMFS109A09+ AACAGCAACACA-CCTGATATAATCTGTGTGAGCTTCAAAGACTTTAACCTTATCCATGG
JMFS089E09+ AACAGCAACACA-CCTGATATAATCTGTGTGAGCTTCAAAGACTTTAACCTTATCCATGG
JMFS165F12+ AACAGCAACACA-CCTGATATAATCTGTGTGAGCTTCAAAGACTTTAACCTTATCCATGG
JMFS084F02+ AACAGCAACACA-CCTGATATAATCTGTGTGAGCTTCAAAGACTTTAACCTTATCCATGG
JMFS104B05+ AACAGCAACACA-CCTGATATAATCTGTGTGAGCTTCAAAGACTTTAACCTTATCCATGG
JMFS160D10+ AACAGCAACACACCCTGATATAATCTGTGTGAGCTTCAAAGACTTTAACCTTATCCATGG
                      ____________________________________________________________
consensus AACAGCAACACA-CCTGATATAATCTGTGTGAGCTTCAAAGACTTTAACCTTATCCATGG
 
. : . : . : . : . : . :
JMFS160G10+ TGTTGTAATTGTACACCCGAATAAACATGTCATCAGCACCAGCAACAACCCACTGCTTGC
JMFS032C04+ TGTTGTAATTGTACACCCGAATAAACATGTCATCAGCACCAGCAACAACCCACTGCTTGC
JMFS021C04+ TGTTGTAATTGTACACCCGAATAAACATGTCATCAGCACCAGCAACAACCCACTGCTTGC
JMFS109A09+ TGTTGTAATTGTACACCCGAATAAACATGTCATCAGCACCAGCAACAACCCACTGCTTGC
JMFS110D05+ CCCACTGCTTGC
JMFS089E09+ TGTTGTAATTGTACACCCGAATAAACATGTCATCAGCACCAGCAACAACCCACTGCTTGC
JMFS165F12+ TGTTGTAATTGTACACCCGAATAAACATGTCATCAGCACCAGCAACAACCCACTGCTTGC
JMFS084F02+ TGTTGTAATTGTACACCCGAATAAACATGTCATCAGCACCAGCAACAACCCACTGCTTGC
JMFS104B05+ TGTTGTAATTGTACACCCGAATAAACATGTCATCAGCACCAGCAACAACCCACTGCTTGC
JMFS160D10+ TGTTGTAATTGTACACCCGAATAAACATGTCATCAGCACCAGCAACAACCCACTGCTTGC
                      ____________________________________________________________
consensus TGTTGTAATTGTACACCCGAATAAACATGTCATCAGCACCAGCAACAACCCACTGCTTGC
 
. : . : . : . : . : . :
JMFS160G10+ GTGCAATGAACTTTGCTGACCTAACTGGTAACTCAGTCACTTCAAAAGATTTTGCCAT
JMFS032C04+ GTGCAATGAACTTTGCTGACCTAACTGGTAACTCAGTCACTTCAAAAGATTTTGCCATTG
JMFS021C04+ GTGCAATGAACTTTGCTGACCTAACTGGTAACTCAGTCACTTCAAAAGATTTTGCCATTG
JMFS109A09+ GTGCAATGAACTTTGCTGACCTAACTGGTAACTCAGTCACTTCAAAAGATTTTGCCATTG
JMFS110D05+ GTGCAATGAACTTTGCTGACCTAACTGGTAACTCAGTCACTTCAAAAGATTTTGCCATTG
JMFS089E09+ GTGCAATGAACTTTGCTGACCTAACTGGTAACTCAGTCACTTCAAAAGATTTTGCCATTG
JMFS165F12+ GTGCAATGAACTTTGCTGACCTAACTGGTAACTCAGTCACTTCAAAAGATTTTGCCATTG
JMFS084F02+ GTGCAATGAACTTTGCTGACCTAACTGGTAACTCAGTCACTTCAAAAGATTTTGCCATTG
JMFS104B05+ GTGCAATGAACTTTGCTGACCTAACTGGTAACTCAGTCACTTCAAAAGATTTTGCCATTG
JMFS160D10+ GTGCAATGAACTTTGCTGACCTAACTGGTAACTCAGTCACTTCAAAAGATTTTGCCATTG
                      ____________________________________________________________
consensus GTGCAATGAACTTTGCTGACCTAACTGGTAACTCAGTCACTTCAAAAGATTTTGCCATTG
 
. : . : . : . : . : . :
JMFS032C04+ CCTGTGTTTGGTAGTTCCAGATGCAAACAGTCCCAGAATACAAACTCGCTAGTATCCATG
JMFS021C04+ CCTGTGTTTGGTAGTTCCAGATGCAAACAGTCCCAGAATACAAACTCGCTAGTATCCATG
JMFS109A09+ CCTGTGTTTGGTAGTTCCAGATGCAAACAGTCCCAGAATACAAACTCGCTAGTATCCATG
JMFS110D05+ CCTGTGTTTGGTAGTTCCAGATGCAAACAGTCCCAGAATACAAACTCGCTAGTATCCATG
JMFS089E09+ CCTGTGTTTGGTAGTTCCAGATGCAAACAGTCCCAGAATACAAACTCGCTAGTATCCATG
JMFS165F12+ CCTGTGTTTGGTAGTTCCAGATGCAAACAGTCCCAGAATACAAACTCGCTAGTATCCATG
JMFS084F02+ CCTGTGTTTGGTAGTTCCAGATGCAAACAGTCCCAGAATACAAACTTGCTAGTATCCATG
JMFS104B05+ CCTGTGTTTGGTAGTTCCAGATGCAAACAGTCCCAGAATACAAACTCGCTAGTATCCATG
JMFS160D10+ CCTGTGTTTGGTAGTTCCAGATGCAAACAGTCCCAGAATACAAACTCGCTAGTATCCATG
                      ____________________________________________________________
consensus CCTGTGTTTGGTAGTTCCAGATGCAAACAGTCCCAGAATACAAACTCGCTAGTATCCATG
 
. : . : . : . : . : . :
JMFS032C04+ GCTCGGTTGGATGCAGATCCACCGACTTTACTCTTTCCGATCTTTGAGCAACTTTTCTCT
JMFS116C11+ ACTTTTCTCT
JMFS021C04+ GCTCGGTTGGATGCAGATCCACCGACTTTACTCTTTCCGATCTTTGAGCAACTTTTCTCT
JMFS109A09+ GCTCGGTTGGATGCAGATCCACCGACTTTACTCTTTCCGATCTTTGAGCAACTTTTCTCT
JMFS110D05+ GCTCGGTTGGATGCAGATCCACCGACTTTACTCTTTCCGATCTTTGAGCAACTTTTCTCT
JMFS089E09+ GCTCGGTTGGATGCAGATCCACCGACTTTACTCTTTCCGATCTTTGAGCAACTTTTCTCT
JMFS165F12+ GCTCGGTTGGATGCAGATCCACCGACTTTACTCTTTCCGATCTTTGAGCAACTTTTCTCT
JMFS084F02+ GCTCGGTTGGATGCAGATCCACCGACTTTACTCTTTCCGATCTTTGAGCAACTTTTCTCT
JMFS104B05+ GCTCGGTTGGATGCAGATCCACCGACTTTACTCTTTCCGATCTTTGAGCAACTTTTCTCT
JMFS160D10+ GCTCGGTTGGATGCAGATCCACCGACTTTACTCTTTCCGATCTTTGAGCAACTTTTCTCT
                      ____________________________________________________________
consensus GCTCGGTTGGATGCAGATCCACCGACTTTACTCTTTCCGATCTTTGAGCAACTTTTCTCT
 
. : . : . : . : . : . :
JMFS032C04+ TGATTTCCAACCTCAGAGGCATATTCACAGATGAAAGGGAAGCTACTTAGATTGAAGAAA
JMFS116C11+ TGATTTCCAACCTCAGAGGCATATTCACAGATGAAAGGGAAGCTACTTAGATTGAAGAAA
JMFS021C04+ TGATTTCCAACCTCAGAGGCATATTCACAGATGAAAGGGAAGCTACTTAGATTGAAGAAA
JMFS109A09+ TGATTTCCAACCTCAGAGGCATATTCACAGATGAAAGGGAAGCTACTTAGATTGAAGAAA
JMFS110D05+ TGATTTCCAACCTCAGAGGCATATTCACAGATGAAAGGGAAGCTACTTAGATTGAAGAAA
JMFS089E09+ TGATTTCCAACCTCAGAGGCATATTCACAGATGAAAGGGAAGCTACTTAGATTGAAGAAA
JMFS165F12+ TGATTTCCAACCTCAGAGGCATATTCACAGATGAAAGGGAAGCTACTTAGATTGAAGAAA
JMFS084F02+ TGATTTCCAACCTCAGAGGCATATTCACAGATGAAAGGGAAGCTACTTAGATTGAAGAAA
JMFS104B05+ TGATTTCCAACCTCAGAGGCATATTCACAGATGAAAGGGAAGCTACTTAGATTGAAGAAA
JMFS160D10+ TGATTTCCAACCTCAGAGGCATATTCACAGATGAAAGGGAAGCTACTTAGATTGAAGAAA
                      ____________________________________________________________
consensus TGATTTCCAACCTCAGAGGCATATTCACAGATGAAAGGGAAGCTACTTAGATTGAAGAAA
 
. : . : . : . : . : . :
JMFS032C04+ CCAATCGGAGATTTGGAAAAATGAGCAGCCCTAGAGATCCAAGCAAAGATCACAGAGGAG
JMFS116C11+ CCAATCGGAGATTTGGAAAAATGAGCAGCCCTAGAGATCCAAGCAAAGATCACAGAGGAG
JMFS021C04+ CCAATCGGAGATTTGGAAAAATGAGCAGCCCTAGAGATCCAAGCAAAGATCACAGAGGAG
JMFS109A09+ CCAATCGGAGATTTGGAAAAATGAGCAGCCCTAGAGATCCAAGCAAAGATCACAGAGGAG
JMFS110D05+ CCAATCGGAGATTTGGAAAAATGAGCAGCCCTAGAGATCCAAGCAAAGATCACAGAGGAG
JMFS089E09+ CCAATCGGAGATTTGGAAAAATGAGCAGCCCTAGAGATCCAAGCAAAGATCACAGAGGAG
JMFS165F12+ CCAATCGGAGATTTGGAAAAATGAGCAGCCCTAGAGATCCAAGCAAAGATCACAGAGGAG
JMFS084F02+ CCAATCGGAGATTTGGAAAAATGAGCAGCCCTAGAGATCCAAGCAAAGATCACAGAGGAG
JMFS104B05+ CCAATCGGAGATTTGGAAAAATGAGCAGCCCTAGAGATCCAAGCAAAGATCACAGAGGAG
JMFS160D10+ CCAATCGGAGATTTGGAAAAATGAGCAGCCCTAGAGATCCAAGCAAAGATCACAGAGGAG
                      ____________________________________________________________
consensus CCAATCGGAGATTTGGAAAAATGAGCAGCCCTAGAGATCCAAGCAAAGATCACAGAGGAG
 
. : . : . : . : . : . :
JMFS032C04+ CGAATCCACTGACGCGCGCGCGCGCAGTCGGGTGCGGAGATCTTCTTCGAATTGGAATTG
JMFS116C11+ CGAATCCACTGACGCGCGCGCGCGCAGTCGGGTGCGGAGATCTTCTTCGAATTGGAATTG
JMFS021C04+ CGAATCCACTGACGCGCGCGCGCGCAGTCGGGTGCGGAGATCTTCTTCGAATTGGAATTG
JMFS109A09+ CGAATCCACTGACGCGCGCGCGCGCAGTCGGGTGCGGAGATCTTCTTCGAATTGGAATTG
JMFS110D05+ CGAATCCACTGACGCGCGCGCGCGCAGTCGGGTGCGGAGATCTTCTTCGAATTGGAATTG
JMFS089E09+ CGAATCCACTGACGCGCGCGCGCGCAGTCGGGTGCGGAGATCTTCTTCGAATTGGAATTG
JMFS165F12+ CGAATCCACTGACGCGCGCGCGCGCAGTCGGGTGCGGAGATCTTCTTCGAATTGGAATTG
JMFS084F02+ CGAATCCACTGACGCGCGCGCGCGCAGTCGGGTGCGGAGATCTTCTTCGAATTGGAATTG
JMFS104B05+ CGAATCCACTGACGCGCGCGCGCGCAGTCGGGTGCGGAGATCTTCTTCGAATTGGAATTG
JMFS160D10+ CGAATCCACTGACGCGCGCGCGCGCAGTCGGGTGCGGAGATCTTCTTCGAATTGGAATTG
                      ____________________________________________________________
consensus CGAATCCACTGACGCGCGCGCGCGCAGTCGGGTGCGGAGATCTTCTTCGAATTGGAATTG
 
. : . : . : . : . : . :
JMFS032C04+ CGGGCCGAGCGATGAAACTCTAATAGA
JMFS116C11+ CGGGCCGAGCGATGAAACTCTAATAGAGAAAGAGAG
JMFS021C04+ CGGGCCGAGCGATGAAACTCTAATAGAGAAAGAGAGATCTCAGGAGAGA
JMFS109A09+ CGGGCCGAGCGATGAAACTCTAATAGAGAAAGAGAGATCTCAGGAGAGAGAAAGTGCAGA
JMFS110D05+ CGGGCCGAGCGATGAAACTCTAATAGAGAAAGAGAGATCTCAGGAGAGAGAAA
JMFS089E09+ CGGGCCGAGCGATGAAACTCTAATAGAGAAAGAGAGATCTCAGGAGAGAGAAAGTGCAGA
JMFS165F12+ CGGGCCGAGCGATGAAACTCTAATAGAGAAAGAGAGATCTCAGGAGAGAGAAAGTGCAGA
JMFS084F02+ CGGGCCGAGCGATGAAACTCTAATAGAGAAAGAGAGATCTCAGGAGAGAGAAAGTGCAGA
JMFS104B05+ CGGGCCGAGCGATGAAACTCTAATAGAGAAAGAGAGATCTCAGGAGAGAGAAAGTGCAGA
JMFS160D10+ CGGGCCGAGCGATGAAACTCTAATAGAGAAAGAGAGATCTCAGGAGAGAGAAAGTGCAGA
                      ____________________________________________________________
consensus CGGGCCGAGCGATGAAACTCTAATAGAGAAAGAGAGATCTCAGGAGAGAGAAAGTGCAGA
 
. : . : . : . : . : . :
JMFS109A09+ GATTGT
JMFS089E09+ GATTGTGCTCATGCCA
JMFS165F12+ GATTGT
JMFS084F02+ GATTGTGCTCATGCCA
JMFS104B05+ GATTGTGCTCATGCCACAGCTAA
JMFS160D10+ GATTGTGCTCATGCCACAGCTAAGTTTCCCTCTGTGATATGCGAGGAAGTGAGGGACGAA
                      ____________________________________________________________
consensus GATTGTGCTCATGCCACAGCTAAGTTTCCCTCTGTGATATGCGAGGAAGTGAGGGACGAA