Previous Contig 004199:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031O11Sequence486004199 (5)gb:T17H3_17235575e-29Arabidopsis thaliana chromosome 1 BAC T17H3 sequence, complete sequence.>gb:AF34798009691 (4)gb:AE013599_11320920.023Drosophila melanogaster chromosome 2R, complete sequence.>gb:AE003808_1225546 Dr
JMFS160C05Sequence584004199 (5)gb:T17H3_17235572e-38Arabidopsis thaliana chromosome 1 BAC T17H3 sequence, complete sequence.>gb:AF34
JMSF015L10Sequence584004199 (5)gb:T17H3_17235573e-38Arabidopsis thaliana chromosome 1 BAC T17H3 sequence, complete sequence.>gb:AF34776009691 (4)gb:AE013599_11320920.022Drosophila melanogaster chromosome 2R, complete sequence.>gb:AE003808_1225546 Dr
JMSF024O20Sequence666004199 (5)gb:AK117509_18155417e-48Arabidopsis thaliana At4g19600 mRNA for unknown protein, complete cds, clone: RA777009691 (4)gb:AE013599_11320920.022Drosophila melanogaster chromosome 2R, complete sequence.>gb:AE003808_1225546 Dr
JMSF045N13Sequence829004199 (5)gb:AK117509_18155418e-70Arabidopsis thaliana At4g19600 mRNA for unknown protein, complete cds, clone: RA741009691 (4)gb:AE013599_11320920.020Drosophila melanogaster chromosome 2R, complete sequence.>gb:AE003808_1225546 Dr

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF045N13+ AGAACCAGCAGCAATGTAGTGGGGCTTGTACTGTAAGCACAGTGTTGATC
                      ____________________________________________________________
consensus AGAACCAGCAGCAATGTAGTGGGGCTTGTACTGTAAGCACAGTGTTGATC
 
. : . : . : . : . : . :
JMSF045N13+ GAAGCCANTCATTCACAAAATTCCATGCAACTTTAGCAAGCTCCTTATGAGAGATTTCCA
                      ____________________________________________________________
consensus GAAGCCANTCATTCACAAAATTCCATGCAACTTTAGCAAGCTCCTTATGAGAGATTTCCA
 
. : . : . : . : . : . :
JMSF024O20+ GCTCATAAGCAA
JMSF045N13+ GCCTCTTTATAGCCGCAACAAGTGGCTTGTAAGGATGTTCGATATTGAGCTCATAAGCAA
                      ____________________________________________________________
consensus GCCTCTTTATAGCCGCAACAAGTGGCTTGTAAGGATGTTCGATATTGAGCTCATAAGCAA
 
. : . : . : . : . : . :
JMSF024O20+ CAGTCGACAATAGAAGTCGCTCACCAGCTAAAACTAATTCTTTATGCTTATCATAAACTT
JMSF045N13+ CAGTCGACAATAGAAGTCGCTCACCAGCTAAAACTAATTCTTTATGCTTATCATAAACTT
                      ____________________________________________________________
consensus CAGTCGACAATAGAAGTCGCTCACCAGCTAAAACTAATTCTTTATGCTTATCATAAACTT
 
. : . : . : . : . : . :
JMSF024O20+ CCTTATCTCTGATTCTTTGTGGGGCAGAAGGATCCCATTTGTATATTAATTTGTATGAAA
JMSF015L10+ TTGTGGGGCAGAAGGATCCCATTNGTATATTAATTTGTATGAAA
JMSF045N13+ CCTTATCTCTGATTCTTTGTGGGGCAGAAGGATCCCATTTGTATATTAATTTGTATGAAA
JMFS160C05+ TTGTGGGGCAGAAGGATCCCATTTGTATATTAATTTGTATGAAA
                      ____________________________________________________________
consensus CCTTATCTCTGATTCTTTGTGGGGCAGAAGGATCCCATTTGTATATTAATTTGTATGAAA
 
. : . : . : . : . : . :
JMSF024O20+ CAACAACAAGATCTGAAAGCCAGCGCGGAGTTTCTTCTACTTTGCAGGCAAGGAACATGC
JMSF015L10+ CAACANCAAGATCTGAAAGCCAGCGCGGAGTTTCTTCTACTTTGCAGGCAAGGAACATGC
JMSF045N13+ CAACAACAAGATCTGAAAGCCAGCGCGGAGTTTCTTCTACTTTGCAGGCAAGGAACATGC
JMFF031O11+ ACTTTGCAGGCAAGGAACATGC
JMFS160C05+ CAACAACAAGATCTGAAAGCCAGCGCGGAGTTTCTTCTACTTTGCAGGCAAGGAACATGC
                      ____________________________________________________________
consensus CAACAACAAGATCTGAAAGCCAGCGCGGAGTTTCTTCTACTTTGCAGGCAAGGAACATGC
 
. : . : . : . : . : . :
JMSF024O20+ ACGCAGTAGCAATAATCTGCCAGTGATTCTTTGTATGAGATTGGCGCATATAAAACTGAT
JMSF015L10+ ACGCAGTAGCAATAATCTGCCAGTGATTCTTTGTATGAGATTGGCGCATATAAAACTGAT
JMSF045N13+ ACGCAGTAGCAATAATCTGCCAGTGATTCTTTGTATGAGATTGGCGCATATAAAACTGAT
JMFF031O11+ ACGCAGTAGCAATAATCTGCCAGTGATTCTTTGTATGAGATTGGCGCATATAAAACTGAT
JMFS160C05+ ACGCAGTAGCAATAATCTGCCAGTGATTCTTTGTATGAGATTGGCGCATATAAAACTGAT
                      ____________________________________________________________
consensus ACGCAGTAGCAATAATCTGCCAGTGATTCTTTGTATGAGATTGGCGCATATAAAACTGAT
 
. : . : . : . : . : . :
JMSF024O20+ GACACAATAGCATTGCAGTTGCAATTGTCACTTGAGGCCCTTTAAGCTCTATCCCAAGCT
JMSF015L10+ GACACAATAGCATTGCAGTTGCAATTGTCACTTGAGGCCCTTTAAGCTCTATCCCAAGCT
JMSF045N13+ GACACAATAGCATTGCAGTTGCAATTGTCACTTGAGGCCCTTTAAGCTCTATCCCAAGCT
JMFF031O11+ GACACAATAGCATTGCAGTTGCAATTGTCACTTGAGGCCCTTTAAGCTCTATCCCAAGCT
JMFS160C05+ GACACAATAGCATTGCAGTTGCAATTGTCACTTGAGGCCCTTTAAGCTCTATCCCAAGCT
                      ____________________________________________________________
consensus GACACAATAGCATTGCAGTTGCAATTGTCACTTGAGGCCCTTTAAGCTCTATCCCAAGCT
 
. : . : . : . : . : . :
JMSF024O20+ CTTGCAAGAATGAGCAGTACAGTTTCCGTAAACCTGATTCTTTCTCATAGTCAATGCCAT
JMSF015L10+ CTTGCAAGAATGAGCAGTACAGTTTCCGTAAACCTGATTCTTTCTCATAGTCAATGCCAT
JMSF045N13+ CTTGCAAGAATGAGCAGTACAGTTTCCGTAAACCTGATTCTTTCTCATAGTCAATGCCAT
JMFF031O11+ CTTGCAAGAATGAGCAGTACAGTTTCCGTAAACCTGATTCTTTCTCATAGTCAATGCCAT
JMFS160C05+ CTTGCAAGAATGAGCAGTACAGTTTCCGTAAACCTGATTCTTTCTCATAGTCAATGCCAT
                      ____________________________________________________________
consensus CTTGCAAGAATGAGCAGTACAGTTTCCGTAAACCTGATTCTTTCTCATAGTCAATGCCAT
 
. : . : . : . : . : . :
JMSF024O20+ CCTTCCTTGATGGAGAATGGTTTTCAATTTCTTCTCTAGAGAAATACCATCTCCTCAAAC
JMSF015L10+ CCTTCCTTGATGGAGAATGGTTTTCAATTTCTTCTCTAGAGAAATACCATCTCCTCAAAC
JMSF045N13+ CCTTCCTTGATGGAGAATGGTTTTCAATTTCTTCTCTAGAGAAATACCATCTCCTCAAAC
JMFF031O11+ CCTTCCTTGATGGAGAATGGTTTTCAATTTCTTCTCTAGAGAAATACCATCTCCTCAAAC
JMFS160C05+ CCTTCCTTGATGGAGAATGGTTTTCAATTTCTTCTCTAGAGAAATACCATCTCCTCAAAC
                      ____________________________________________________________
consensus CCTTCCTTGATGGAGAATGGTTTTCAATTTCTTCTCTAGAGAAATACCATCTCCTCAAAC
 
. : . : . : . : . : . :
JMSF024O20+ TTTGAGGGTCTTCTTGCAGGTACTTACTCAATGCAATACTTTGAGCTTTATGATGAGAAG
JMSF015L10+ TTTGAGGGTCTTCTTGCAGGTACTTACTCAATGCAATACTTTGAGCTTTATGATGAGAAG
JMSF045N13+ TTTGAGGGTCTTCTTGCAGGTACTTACTCAATGCAATACTTTGAGCTTTATGATGAGAAG
JMFF031O11+ TTTGAGGGTCTTCTTGCAGGTACTTACTCAATGCAATACTTTGAGCTTTATGATGAGAAG
JMFS160C05+ TTTGAGGGTCTTCTTGCAGGTACTTACTCAATGCAATACTTTGAGCTTTATGATGAGAAG
                      ____________________________________________________________
consensus TTTGAGGGTCTTCTTGCAGGTACTTACTCAATGCAATACTTTGAGCTTTATGATGAGAAG
 
. : . : . : . : . : . :
JMSF024O20+ GATACCCAGGCAGTTGTCCTGCCATCACGTCCCTCGGTTCTCAGCAGCAAATAAATTTCT
JMSF015L10+ GATACCCAGGCAGTTGTCCTGCCATCACGTCCCTCGGTTCTCAGCAGCAAATAAATTTCT
JMSF045N13+ GATACCCAGGCAGTTGTCCTGCCATCACGTCCCTCGGTTCTCAGCAGCAAATAAATTTCT
JMFF031O11+ GATACCCAGGCAGTTGTCCTGCCATCACGTCCCTCGGTTCTCAGCAGCAAATAAATTTCT
JMFS160C05+ GATACCCAGGCAGTTGTCCTGCCATCACGTCCCTCGGTTCTCAGCAGCAAATAAATTTCT
                      ____________________________________________________________
consensus GATACCCAGGCAGTTGTCCTGCCATCACGTCCCTCGGTTCTCAGCAGCAAATAAATTTCT
 
. : . : . : . : . : . :
JMSF024O20+ GATGTTTTGACAATCCCTCTGATAGCAAACACAGATGAATATTCTGAATCTGCGAAAGAT
JMSF015L10+ GATGTTTTGACAATCCCTCTGATAGCAAACACAGATGAATATTCTGAATCTGCGAAAGAT
JMSF045N13+ GATGTTTTGACAATCCCTCTGATAGCAAACACAGATGAATATTCTGAATCTGCGAAAGAT
JMFF031O11+ GATGTTTTGACAATCCCTCTGATAGCAAACACAGATGAATATTCTGAATCTGCGAAAGAT
JMFS160C05+ GATGTTTTGACAATCCCTCTGATAGCAAACACAGATGAATATTCTGAATCTGCGAAAGAT
                      ____________________________________________________________
consensus GATGTTTTGACAATCCCTCTGATAGCAAACACAGATGAATATTCTGAATCTGCGAAAGAT
 
. : . : . : . : . : . :
JMSF024O20+ CTCCCTGCAAAAATTGTTCGAGCGACAGGAAGCAGCGTGACGATGCCCTTGT
JMSF015L10+ CTCCCTGCAAAAATTGTTCGAGCGACAGGAAGCAGCGTGACGATGCCCTTGT
JMSF045N13+ CTCCCTGCAAAAATTGTTCGAGCGACAGGAAGCAGCGTGACGATGCCCTTGT
JMFF031O11+ CTCCCTGCAAAAATTGTTCGAGCGACAGGAAGCAGCGTGACGAT
JMFS160C05+ CTCCCTGCAAAAATTGTTCGAGCGACAGGAAGCAGCGTGACGATGCCCTTGTCGTTCTGG
                      ____________________________________________________________
consensus CTCCCTGCAAAAATTGTTCGAGCGACAGGAAGCAGCGTGACGATGCCCTTGTCGTTCTGG