Previous Contig 004198:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS139A09Sequence261004198 (2)
JMFS160B07Sequence545004198 (2)gb:AY093054_15750083e-16Arabidopsis thaliana unknown protein (At3g21090) mRNA, complete cds.>gb:BT000405

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS160B07+ TGGCC
                      ____________________________________________________________
consensus TGGCC
 
. : . : . : . : . : . :
JMFS160B07+ AGCCTACCTGTTAAGGAATCAAGAAGGGTGGATTGCCAGAGCCAGAAGGACCCATAATGG
                      ____________________________________________________________
consensus AGCCTACCTGTTAAGGAATCAAGAAGGGTGGATTGCCAGAGCCAGAAGGACCCATAATGG
 
. : . : . : . : . : . :
JMFS160B07+ CCATAATCNTACCAGGTTCAGCATACCCACTGATCCCTTGAAGCAGCTTCTTGGTTGGGC
                      ____________________________________________________________
consensus CCATAATCNTACCAGGTTCAGCATACCCACTGATCCCTTGAAGCAGCTTCTTGGTTGGGC
 
. : . : . : . : . : . :
JMFS160B07+ CTTGTCCAAAATTTGGAAGCACCACTGTTAAGTCTTCCCACACCAAGTAAGCCACCCCCT
                      ____________________________________________________________
consensus CTTGTCCAAAATTTGGAAGCACCACTGTTAAGTCTTCCCACACCAAGTAAGCCACCCCCT
 
. : . : . : . : . : . :
JMFS139A09+ AATATCCCCTCCTCTACCACCCCCACCACCCGCCGCCT
JMFS160B07+ GCNTATGCACCACCCCTCTCTCAATATCCCCTCCTCTACCACCCCCACCACCCGCCGCCT
                      ____________________________________________________________
consensus GCNTATGCACCACCCCTCTCTCAATATCCCCTCCTCTACCACCCCCACCACCCGCCGCCT
 
. : . : . : . : . : . :
JMFS139A09+ CTATCTCCATGACCCCCCCTATGCAAAGCTCAAATCTTTAAGCAACCCAACCACCAATGC
JMFS160B07+ CTATCTCCATGACCCCCCCTATGCAAAGCTCAAATCTTTAAGCAACCCAACCACCAATGC
                      ____________________________________________________________
consensus CTATCTCCATGACCCCCCCTATGCAAAGCTCAAATCTTTAAGCAACCCAACCACCAATGC
 
. : . : . : . : . : . :
JMFS139A09+ CCCTCCAATCTTGATGATGAACACTGCCCAGTTGTATATCACACCTTTGTAGCCCTCAAA
JMFS160B07+ CCCTCCAATCTTGATGATGAACACTGCCCAGTTGTATATCACACCTTTGTAGCCCTCAAA
                      ____________________________________________________________
consensus CCCTCCAATCTTGATGATGAACACTGCCCAGTTGTATATCACACCTTTGTAGCCCTCAAA
 
. : . : . : . : . : . :
JMFS139A09+ AATCAGCAAAAATCCAAAAAGCTCAAGTCTTGCATCTCTGGGTATACATACACATACTCA
JMFS160B07+ AATCAGCAAAAATCCAAAAAGCTCAAGTCTTGCATCTCTGGGTATACATACACATACTCA
                      ____________________________________________________________
consensus AATCAGCAAAAATCCAAAAAGCTCAAGTCTTGCATCTCTGGGTATACATACACATACTCA
 
. : . : . : . : . : . :
JMFS139A09+ TACACACCAAATATAAGAACATAAAGAGATATGGGGCAAGGTT
JMFS160B07+ TACACACCAAATATAAGAACATAAAGAGATATGGGGCAAGGTTTATGGCAATGGGGGATA
                      ____________________________________________________________
consensus TACACACCAAATATAAGAACATAAAGAGATATGGGGCAAGGTTTATGGCAATGGGGGATA
 
. : . : . : . : . : . :
JMFS160B07+ TGAGTGGAAAGTGATGGGGGGTGGGGAGACTTTAATGTGGGGATGGTGGTGTGTACAGTT
                      ____________________________________________________________
consensus TGAGTGGAAAGTGATGGGGGGTGGGGAGACTTTAATGTGGGGATGGTGGTGTGTACAGTT