Previous Contig 004193:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001G05Sequence528004193 (52)gb:AY291285_15956183e-40Gossypium hirsutum chitinase-like protein (CTL1) mRNA, complete cds.731004193 (52)gb:AY291286_15956197e-59Gossypium hirsutum chitinase-like protein (CTL2) gene, complete cds.
JMFF009I22Sequence618004193 (52)gb:AB087832_15247175e-64Pisum sativum mRNA for class1 chitinase, partial cds.669004193 (52)gb:AB087832_15247171e-51Pisum sativum mRNA for class1 chitinase, partial cds.
JMFF011O19Sequence563004193 (52)gb:AB026636_15170501e-58Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17.>gb:AY090261_15689004193 (52)gb:AY291286_15956191e-47Gossypium hirsutum chitinase-like protein (CTL2) gene, complete cds.
JMFF012G20Sequence297004193 (52)gb:AF527943_18085242e-38Gossypium hirsutum class VII chitinase precursor (Chia7) mRNA, complete cds.>gb:
JMFF013J03Sequence594004193 (52)gb:AB026636_15170503e-59Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17.>gb:AY090261_15677004193 (52)gb:AB087832_15247173e-50Pisum sativum mRNA for class1 chitinase, partial cds.
JMFF013O08Sequence575004193 (52)gb:AB026636_15170504e-53Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17.>gb:AY090261_15684004193 (52)gb:AB087832_15247171e-51Pisum sativum mRNA for class1 chitinase, partial cds.
JMFF017D20Sequence577004193 (52)gb:AB026636_15170503e-59Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17.>gb:AY090261_15805004193 (52)gb:AB087832_15247177e-73Pisum sativum mRNA for class1 chitinase, partial cds.
JMFF022E17Sequence516004193 (52)gb:AY291285_15956184e-41Gossypium hirsutum chitinase-like protein (CTL1) mRNA, complete cds.662004193 (52)gb:AY291286_15956195e-46Gossypium hirsutum chitinase-like protein (CTL2) gene, complete cds.
JMFF023L04Sequence473004193 (52)gb:AY291285_15956189e-40Gossypium hirsutum chitinase-like protein (CTL1) mRNA, complete cds.701004193 (52)gb:AB087832_15247172e-52Pisum sativum mRNA for class1 chitinase, partial cds.
JMFF023P21Sequence725004193 (52)gb:AB087832_15247173e-57Pisum sativum mRNA for class1 chitinase, partial cds.
JMFF029B05Sequence582004193 (52)gb:AB026636_15170505e-60Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17.>gb:AY090261_15640004193 (52)gb:AY291286_15956192e-41Gossypium hirsutum chitinase-like protein (CTL2) gene, complete cds.
JMFF031M07Sequence505004193 (52)gb:AY291285_15956184e-41Gossypium hirsutum chitinase-like protein (CTL1) mRNA, complete cds.673004193 (52)gb:AB087832_15247172e-52Pisum sativum mRNA for class1 chitinase, partial cds.
JMFF032N20Sequence328004193 (52)pir|C86193|C861934e-07hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889603 Arabid
JMFF035M09Sequence625004193 (52)gb:AB026636_15170504e-59Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17.>gb:AY090261_15669004193 (52)gb:AY291286_15956191e-45Gossypium hirsutum chitinase-like protein (CTL2) gene, complete cds.
JMFF037E21Sequence528004193 (52)gb:AY291285_15956185e-47Gossypium hirsutum chitinase-like protein (CTL1) mRNA, complete cds.734004193 (52)gb:AY291286_15956192e-63Gossypium hirsutum chitinase-like protein (CTL2) gene, complete cds.
JMFF038C18Sequence544004193 (52)gb:AY291285_15956181e-47Gossypium hirsutum chitinase-like protein (CTL1) mRNA, complete cds.
JMFF038G07Sequence679004193 (52)gb:AB087832_15247173e-51Pisum sativum mRNA for class1 chitinase, partial cds.
JMFF046K04Sequence578004193 (52)gb:AY291285_15956186e-47Gossypium hirsutum chitinase-like protein (CTL1) mRNA, complete cds.542004193 (52)gb:AY291286_15956191e-16Gossypium hirsutum chitinase-like protein (CTL2) gene, complete cds.
JMFF051J03Sequence616004193 (52)gb:AB087832_15247172e-64Pisum sativum mRNA for class1 chitinase, partial cds.328004193 (52)
JMFN010M10Sequence624004193 (52)gb:AB087832_1524717e-103Pisum sativum mRNA for class1 chitinase, partial cds.
JMFN042J06Sequence441004193 (52)gb:AY291286_15956191e-27Gossypium hirsutum chitinase-like protein (CTL2) gene, complete cds.
JMFS038D05Sequence612004193 (52)gb:AB087832_15247171e-69Pisum sativum mRNA for class1 chitinase, partial cds.
JMFS112C04Sequence536004193 (52)gb:AY291286_15956197e-15Gossypium hirsutum chitinase-like protein (CTL2) gene, complete cds.
JMFS159E02Sequence463004193 (52)gb:AB026636_15170501e-20Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17.>gb:AY090261_15
JMFS166C07Sequence631004193 (52)gb:AB026636_15170504e-59Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17.>gb:AY090261_15
JMSF011N15Sequence236004193 (52)796004193 (52)gb:AB087832_15247171e-68Pisum sativum mRNA for class1 chitinase, partial cds.
JMSF019B09Sequence227004193 (52)772004193 (52)gb:AB087832_15247174e-76Pisum sativum mRNA for class1 chitinase, partial cds.
JMSF020O01Sequence659004193 (52)gb:AB026636_15170504e-75Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17.>gb:AY090261_15770022948gb:AB087832_15247172e-75Pisum sativum mRNA for class1 chitinase, partial cds.
JMSF027A19Sequence403004193 (52)gb:AB026636_15170502e-19Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17.>gb:AY090261_15222004193 (52)pir|C86193|C861932e-04hypothetical protein [imported] - Arabidopsis thaliana>gb:AE005172_889603 Arabid
JMSF029H07Sequence622004193 (52)gb:AB087832_15247175e-72Pisum sativum mRNA for class1 chitinase, partial cds.732004193 (52)gb:AY291286_15956192e-58Gossypium hirsutum chitinase-like protein (CTL2) gene, complete cds.
JMSF029I11Sequence626004193 (52)gb:AB026636_15170508e-59Arabidopsis thaliana genomic DNA, chromosome 3, TAC clone:K14A17.>gb:AY090261_15747004193 (52)gb:AB087832_15247173e-69Pisum sativum mRNA for class1 chitinase, partial cds.
JMSF032C03Sequence691004193 (52)gb:AB087832_15247175e-84Pisum sativum mRNA for class1 chitinase, partial cds.743004193 (52)gb:AB087832_15247174e-69Pisum sativum mRNA for class1 chitinase, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF011N15- CA
                      ____________________________________________________________
consensus CA
 
. : . : . : . : . : . :
rJMFF046K04- GTCTTCACAATTGATAGATATAT-GTGTAAGAGTTCACATTACATAAAATAT-
JMFS112C04+ GTCTTCACAATTGATAGATATAT-GTGTAAGAGTTCACATTACATAAAATAT-
rJMFF051J03- GAGTCTTCACAATTGATATATATAT-GTGTAATATTTCACATTACTTAAAATAT-
rJMFF035M09- TTTGAGTCTTCACAATTGATAGATATAT-GTGTAAGAGTTCACATTACATAAAATAT-
rJMFF023L04- TTTGAGTCTTCACAATTGATAGATATAT-GTGTAAGAGTTCACATTACATAAAATAT-
rJMSF011N15- CATTTGAGTCTTCACAATTGATAGATATAT-GTGTAAGAGTTCACATTACATAAAATAT-
rJMSF029I11- TAAAATAT-
rJMSF032C03- TAAAATAT-
rJMFF037E21- TAT-GTGTAAGAGTTCACATTACATAAAATAT-
rJMFF038G07- GTGTAAGAGTTCACATTACATAAAATAT-
rJMFF023P21- TGATAGATATATGGTGTAAGAGTTCACATTACATAAAATAT-
rJMFF013O08- ATTGATAGATATAT-GTGTAAGAGTTCACATTACATAAAATAT-
rJMFF011O19- TAT-GTGTAAGAGTTCACATTACATAAAATAT-
rJMFF013J03- ATTGATAGATATAT-GTGTAAGAGTTCACATTACATAAAATAT-
rJMFF029B05- TAT-GTGTAAGAGTTCACATTACATAAAATAT-
rJMFF001G05- ATTGATAGATATAT-GTGTAAGAGTTCACATTACATAAAATAT-
rJMSF029H07- AGAGTTCACATTACATAAAATAT-
rJMFF022E17- TTGAGTCTTC-CAATTGATAGATATAT-GTGTAAGAGTTCACATTACATAAAATAT-
rJMFF009I22- TAT-GTGTAAGAGTTCACATTACATAAAATAT-
rJMFF031M07- TAT-GTGTAAGAGTTCACATTACATAAAATATG
rJMFF017D20- TTGAGTCTTC-CAATTGATAGATATAT-GTGTAAGAGTTCACATTACATAAAATAT-
rJMSF019B09- AAAATAT-
                      ____________________________________________________________
consensus CATTTGAGTCTTCACAATTGATAGATATAT-GTGTAAGAGTTCACATTACATAAAATAT-
 
. : . : . : . : . : . :
rJMFF046K04- GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
JMFS112C04+ GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
rJMFF051J03- GCCCAACCTCATTACTACACCATGCACAAATACACCAACTATATGAACACCCAATGAATC
rJMFF035M09- GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
rJMFF023L04- GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
rJMSF011N15- GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
rJMSF029I11- GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
rJMSF032C03- GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
rJMFF037E21- GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
rJMFF038G07- GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
rJMFF023P21- GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
rJMFF013O08- GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
rJMFF011O19- GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
rJMFF013J03- GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAACC
rJMFF029B05- GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
rJMFF001G05- GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
rJMSF029H07- GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
rJMFF022E17- GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
rJMFF009I22- GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
rJMFF031M07- GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
rJMFF017D20- GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
rJMSF019B09- GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
                      ____________________________________________________________
consensus GCCAAACCTCATTACTACACCATGCACAAATACACAAACTATATGAACACCAAATGAATC
 
. : . : . : . : . : . :
rJMFF046K04- CCAAAAATCTATAGAACACATCACAAGAACGGCAACATCAATATATGTAATATGATCCCC
rJMFF032N20- AGAACGGCAACATCAATATATGTAATATGATCCCC
JMFS112C04+ CCAAAAATCTATAGAACACATCACAAGAACGGCAACATCAATATATGTAATATGATCCCC
rJMFF051J03- CCAAAAATCTATAGAACACATCACAAAAACGGCAACCTCCATATATGTACTATGATCCCC
rJMFF035M09- CCAAAAATCTATAGAACACATCACAAGAACGGCAACATCAATATATGTAATATGATCCCC
rJMFF023L04- CCAAAAATCTATAGAACACATCACAAGAACAGCAACATCAATATATGTAATATGATCCCC
rJMSF011N15- CCAAAAATCTATAGAACACATCACAAGAACGGCAACATCAATATATGTAATATGATCCCC
rJMSF029I11- CCAAAAATCTATAGAACACATCACAAGAACGGCAACATCAATATATGTAATATGATCCCC
rJMSF032C03- CCAAAAATCTATAGAACACATCACAAGAACGGCAACATCAATATATGTAATATGATCCCC
rJMFF037E21- CCAAAAATCTATAGAACACATCACAAGAACGGCAACATCAATATATGTAATATGATCCCC
rJMFF038G07- CCAAAAATCTATAGAACACATCACAAGAACGGCAACATCAATATATGTAATATGATCCCC
rJMFF023P21- CCAAAAATCTATAGAACACATCACAAGAACGGCAACATCAATATATGTAATATGATCCCC
rJMFF013O08- CCAAAAATCTATAGAACACATCACAAGAACGGCAACATCAATATATGTAATATGATCCCC
rJMFF011O19- CCAAAAATCTATAGAACACATCACAAGAACGGCAACATCAATATATGTAATATGATCCCC
rJMFF013J03- CCAAAAATCTATAGAACACATCACAAGAACGGCAACATCAATATATGTAATATGATCCCC
rJMFF029B05- CCAAAAATCTATAGAACACATCACAAGAACGGCAACATCAATATATGTAATATGATCCCC
JMFN042J06+ CATCAATATATGTAATATGATCCCC
rJMFF001G05- CCAAAAATCTATAGAACACATCACAAGAACGGCAACATCAATATATGTAATATGATCCCC
rJMSF029H07- CCAAAAATCTATAGAACACATCACAAGAACGGCAACATCAATATATGTAATATGATCCCC
rJMFF022E17- CCAAAAATCTATAGAACACATCACAAGAACGGCAACATCAATATATGTAATATGATCCCC
rJMFF009I22- CCAAAAATCTATAGAACACATCACAAGAACGGCAACATCA--ATATGTAATATGATCCCC
rJMFF031M07- CCAAAAATCTATAGAACACATCACAAGAACGGCAACATCA--ATATGTAATATGATCCCC
rJMFF017D20- CCAAAAATCTATAGAACACATCACAAGAACGGCAACATCAATATATGTAATATGATCCCC
rJMSF019B09- CCAAAAATCTATAGAACACATCACAAGAACGGCAA-ATCAATATATGTAATATGATCCCC
                      ____________________________________________________________
consensus CCAAAAATCTATAGAACACATCACAAGAACGGCAACATCAATATATGTAATATGATCCCC
 
. : . : . : . : . : . :
rJMFF046K04- ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
rJMFF032N20- ACTGTANTATATTTATAGCTTCATTCATGANTTTATAGAGCAGGAGCGAAATCGNAAGGG
rJMSF027A19- GGG
JMFS112C04+ ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
rJMFF051J03- ACTGAAATATATTTAAAGCTTCATTCCTGAATTTAGAGAGCAGGACCCAAATCGCAAGGG
rJMFF035M09- ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
rJMFF023L04- ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
rJMSF011N15- ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
rJMSF029I11- ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
rJMSF032C03- ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
rJMFF037E21- ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
rJMFF038G07- ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
rJMFF023P21- ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
rJMFF013O08- ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
rJMFF011O19- ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
rJMFF013J03- ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
rJMFF029B05- ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
JMFN042J06+ ACTGTAATATATTTAGACCTTCAGTCATGA-TTTAGAGAGCAGGAGGGAAATCGCAAGGG
rJMFF001G05- ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
rJMSF029H07- ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
rJMFF022E17- ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
rJMFF009I22- ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
rJMFF031M07- ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
rJMFF017D20- ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
rJMSF019B09- ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
                      ____________________________________________________________
consensus ACTGTAATATATTTAGAGCTTCATTCATGAGTTTAGAGAGCAGGAGCGAAATCGCAAGGG
 
. : . : . : . : . : . :
rJMFF046K04- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
rJMFF032N20- GAAGGTGAAATCNTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTANATGGTTGANGC
rJMSF027A19- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAANTGGTTGAGGC
JMFS112C04+ GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
rJMFF051J03- GAAGGAGAAATCTTACTCGCTCCTCAAATTGCACGCTTTGTTCTTGCAAAAGGTTGA
rJMFF035M09- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
rJMFF023L04- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
rJMSF011N15- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
rJMSF029I11- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
rJMSF032C03- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
rJMFF037E21- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
rJMFF038G07- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
rJMFF023P21- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
rJMFF013O08- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
rJMFF011O19- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
rJMFF013J03- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
rJMFF029B05- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
JMFN042J06+ GAAGGTGAAATCGTGCTCGGTCCTAGTATGGCGCGCTTGGTTGTTGTAAATGGTTGGGGC
rJMFF001G05- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
rJMSF029H07- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
rJMFF022E17- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
rJMFF009I22- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
rJMFF031M07- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
rJMFF017D20- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
rJMSF019B09- GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
                      ____________________________________________________________
consensus GAAGGTGAAATCGTACTCGCTCCTCTTATTGCACGCTTTGTTCTTGTAAATGGTTGAGGC
 
. : . : . : . : . : . :
rJMFF046K04- CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
rJMFF032N20- CACAACANCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
rJMSF027A19- CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCNANAGGAAGAGGAAG
JMFS112C04+ CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
rJMFF035M09- CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
rJMFF023L04- CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
rJMSF011N15- CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
rJMSF029I11- CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
rJMSF032C03- CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
rJMFF037E21- CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
rJMFF038G07- CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
rJMFF023P21- CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
rJMFF013O08- CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
rJMFF011O19- CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
rJMFF013J03- CACAACACC-GGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
rJMFF029B05- CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
JMFN042J06+ CGCAACACCGGGGGGAAAGAATGTAATATGGCACAGATGGACCTCAAGAGGAAGAGGAAG
rJMFF001G05- CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
rJMSF029H07- CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
rJMFF022E17- CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
rJMFF009I22- CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
rJMFF031M07- CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
rJMFF017D20- CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
rJMSF019B09- CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
                      ____________________________________________________________
consensus CACAACACCGGGGGGAAAGAATCTAATATGGCACAGATCGACCTCAAGAGGAAGAGGAAG
 
. : . : . : . : . : . :
rJMFF046K04- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
rJMFF032N20- ACTTCGAGGATGGATTGAANGGTTTTTGTTCTGCACAGGTCNCAACGTCNTGGGGCCCAG
rJMSF027A19- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACCNGNCAGAACGTCNTGNGGCCCAG
JMFS112C04+ ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
rJMFF035M09- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
rJMFF023L04- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
rJMSF011N15- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
rJMSF029I11- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
rJMSF032C03- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
rJMFF037E21- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
rJMFF038G07- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
rJMFF023P21- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
rJMFF013O08- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
rJMFF011O19- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
rJMFF013J03- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
rJMFF029B05- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
JMFN042J06+ ACTTCGAGAATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
rJMFF001G05- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
rJMSF029H07- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
rJMFF022E17- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
rJMFF009I22- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
rJMFF031M07- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
rJMFF017D20- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
rJMSF019B09- ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
                      ____________________________________________________________
consensus ACTTCGAGGATGGATTGAAGGGTTTTTGTTCTGCACAGGTCAGAACGTCGTGGGGCCCAG
 
. : . : . : . : . : . :
rJMFF046K04- CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
rJMFF032N20- CTTCCTCGCGGCCAACNCCCAGNAAGTCCAGGTAGNACTGGTAATGGGA
rJMSF027A19- CTTCCTCGCGGCCAACACCCANTAAGTCCAGGTAG
JMFS112C04+ CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
rJMFF035M09- CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
rJMFF023L04- CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
rJMSF011N15- CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
rJMSF029I11- CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
rJMSF032C03- CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
rJMFF037E21- CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
rJMFF038G07- CTCCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
rJMFF023P21- CTCCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
rJMFF013O08- CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
rJMFF011O19- CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
rJMFF013J03- CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
rJMFF029B05- CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
JMFN042J06+ CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
rJMFF001G05- CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
rJMSF029H07- CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
rJMFF022E17- CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
rJMFF009I22- CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
rJMFF031M07- CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
rJMFF017D20- CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
rJMSF019B09- CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
                      ____________________________________________________________
consensus CTTCCTCGCGGCCAACACCCAGTAAGTCGAGGTAGTACTGGTAATGGGAGATGATGTTGT
 
. : . : . : . : . : . :
rJMFF046K04- TCATGGAATCCACGTCGCCTTGACCGCA
JMFS112C04+ TCATGGAATCCACGTCGCCTTGAC
rJMFF035M09- TCATGGAATCCACGTCGCCTTGACCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
rJMFF023L04- TCATGGAATCCACGTCGCCTTGACCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
rJMSF011N15- TCATGGAATCCACGTCGCCTTGACCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
rJMSF029I11- TCATGGAATCCACGTCGCCTTGACCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
rJMSF032C03- TCATGGAATCCACGTCGCCTTGACCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
rJMFF037E21- TCATGGAATCCACGTCGCCTTGACCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
rJMFF038G07- TCATGGAATCCACGTCGCCTTGACCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
rJMFF023P21- TCATGGAATCCACGTCGCCTTGACCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
rJMFF013O08- TCATGGAATCCACGTCGCCTTGACCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
rJMFF011O19- TCATGGAATCCACGTCGCCTTGACCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
rJMFF013J03- TCATGGAATCCACGTCGCCTTGACCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
rJMFF029B05- TCATGGAATCCACGTCGCCTTGACCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
JMFN042J06+ TCATGGAATCCACGTCGCCTTGGCCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
rJMFF001G05- TCATGGAATCCACGTCGCCTTGACCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
rJMSF029H07- TCATGGAATCCACGTCGCCTTGACCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
rJMFF022E17- TCATGGAATCCACGTCGCCTTGACCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
rJMFF009I22- TCATGGAATCCACGTCGCCTTGACCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
rJMFF031M07- TCATGGAATCCACGTCGCCTTGACCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
rJMFF017D20- TCATGGAATCCACGTCGCCTTGACCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
rJMSF019B09- TCATGGAATCCACGTCGCCTTGACCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
JMFN010M10+ ATACAAGATCGCCGTAGAGTATATTCAAGGTGG
                      ____________________________________________________________
consensus TCATGGAATCCACGTCGCCTTGACCGCATACAAGATCGCCGTAGAGTATATTCAAGGTGG
 
. : . : . : . : . : . :
rJMFF035M09- TACCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
rJMFF023L04- TACCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
rJMSF011N15- TACCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
rJMSF029I11- TACCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
rJMSF032C03- TACCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
rJMFF037E21- TACCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
rJMFF038G07- TACCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
rJMFF023P21- TACCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
rJMFF013O08- TACCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
rJMFF011O19- TACCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
rJMFF013J03- TACCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
rJMFF029B05- TACCGAAGCCAGGAACTCTATGTTCTANAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
JMFN042J06+ TAGCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTC
rJMFF001G05- TACCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
rJMSF029H07- TACCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
rJMFF022E17- TACCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
rJMFF009I22- TACCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
rJMFF031M07- TACCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
rJMFF017D20- TACCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
rJMSF019B09- TACCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
JMFN010M10+ TACCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
                      ____________________________________________________________
consensus TACCGAAGCCAGGAACTCTATGTTCTAGAGTGTCGTTCTTGGTGGGCTTCCAGTTACCGA
 
. : . : . : . : . : . :
rJMFF035M09- CGAAAGCATCATGGGCCGAANGCTGTCCCTTCTTAACC-GGGGTCATCCACC-GCCACAT
rJMFF023L04- CGAAAGCATCATGGGCCGAAGGCTGTCCCTTCTTAACC-GGGGTCATCCACC-GCCACAT
rJMSF011N15- CGAAAGCATCATGGGCCGAAGGCTGTCCCTTCTTAACC-GGGGTCATCCACA-GCCACAT
rJMSF029I11- CGAAAGCATCATGGGCCGAAGGCTGTCCCTTCTTAACC-GGGGTCATCCACC-GCCACAT
rJMSF032C03- CGAAAGCATCATGGGCCGAAGGCTGTCCCTTCTTAACC-GGGGTCATCCACC-GCCACAT
rJMFF037E21- CGAAAGCATCATGGGCCGAAGGCTGTCCCTTCTTAACC-GGGGTCATCCACC-GCCACAT
rJMFF038G07- CGAAAGCATCATGGGCCGAAGGCTGTCCCTTCTTAACC-GGGGTCATCCACC-GCCACAT
rJMFF023P21- CGAAAGCATCATGGGCCGAAGGCTGTCCCTTCTTAACC-GGGGTCATCCACC-GCCACAT
rJMFF013O08- CGAAAGCATCATGGGCCGAAGGCTGTCCCTTCTTAACC-GGGGTCATCCACC-GCCACAT
rJMFF011O19- CGAAAGCATCATGGGCCGAANGCTGTCCCTTCTTAACCGGGGGTCATCCACC-GCCACAT
rJMFF013J03- CGAAAGCATCATGGGCCGAAGGCTGTCCCTTCTTAACC-GGGGTCATCCACC-GCCACAT
rJMFF029B05- CGAAAGCATCATGGGCCGAANGCTGTCCCTTCTTAACC-GGGGTCATCCACCGGCCACAT
rJMFF001G05- CGAAAGCATCATGGGCCGAAGGCTGTCCCTTCTTAACC-GGGGTCATCCACC-GCCACAT
rJMSF029H07- CGAAAGCATCATGGGCCGAAGGCTGTCCCTTCTTAACC-GGGGTCATCCACC-GCCACAT
rJMFF022E17- CGAAAGCATCATGGGCCGAAGGCTGTCCCTTCTTAACC-GGGGTCATCCACC-GCCACAT
rJMFF009I22- CGAAAGCATCATGGGCCGAAGGCTGTCCCTTCTTAACC-GGGGTCATCCACC-GCCACAT
rJMFF031M07- CGAAAGCATCATGGGCCGAAGGCTGTCCCTTCTTAACC-GGGGTCATCCACC-GCCACAT
rJMFF017D20- CGAAAGCATCATGGGCCGAAGGCTGTCCCTTCTTAACC-GGGGTCATCCACC-GCCACAT
rJMSF019B09- CGAAAGCATCATGGGCCGAAGGCTGTCCCTTCTTAACC-GGGGTCATCCACC-GCCACAT
JMFN010M10+ CGAAAGCATCATGGGCCGAAGGCTGTCCCTTCTTAACC-GGGGTCATCCACC-GCCACAT
                      ____________________________________________________________
consensus CGAAAGCATCATGGGCCGAAGGCTGTCCCTTCTTAACC-GGGGTCATCCACC-GCCACAT
 
. : . : . : . : . : . :
rJMFF035M09- TGCAGCCTGGAAA
rJMFF023L04- TGCAGCCTGGAAAGCCAAGGTGGCGTTTTGCTCGATGTATTCGGG
rJMSF011N15- TGCAGCCTGGAAAGCCAAGGTGGCGTTTTGCTCGATGTATTCGGGGTGGTTCAAGAGATC
rJMSF029I11- TGCAGCCTGGAAAGCCAAGGTGGCGTTTTGCTCGATGTATTCGGGGTGGTTCAAGAGATC
rJMSF032C03- TGCAGCCTGGAAAGCCAAGGTGGCGTTTTGCTCGATGTATTCGGGGTGGTTCAAGAGATC
rJMFF037E21- TGCAGCCTGGAAAGCCAAGGTGGCGTTTTGCTCGATGTATTCGGGGTGGTTCAAGAGATC
rJMFF038G07- TGCAGCCTGGAAAGCCAAGGTGGCGTTTTGCTCGATGTATTCGG
rJMFF023P21- TGCAGCCTGGAAAGCCAAGGTGGCGTTTTGCTCGATGTATTCGGGGTGGTTCAAGAGATC
rJMFF013O08- TGCAGCCTGGAAAGCCAAGGTGGCGTTTTGCTCGATGTATTC
rJMFF011O19- TGCAGCCTGGAAAGCCAANGTGGCGTTTTGCTCGATGTATTCGGGGTGGTTCAAGAGAT
rJMFF013J03- TGCAGCCTGGAAAGCCAAGGTGGCGTTTTGCTCGATGT
rJMFF029B05- TGCAGCCTGG
rJMFF001G05- TGCAGCCTGGAAAGCCAAGGTGGCGTTTTGCTCGATGTATTCGGGGTGGTTCAAGAGATC
rJMSF029H07- TGCAGCCTGGAAAGCC-AGGTGGCGTTTTGCTCGATGTATTCGGGGTGGTTCAAGAGATC
rJMFF022E17- TGCAGCCTGG
rJMFF009I22- TGCAGCCTGGAAAGCCAAGGTGGCGTTTTGCTCGATGTATTC
rJMFF031M07- TGCAGCCTGGAAAGCCAAGGTGGCGTTTTGCTCGATGTATTC
rJMFF017D20- TGCAGCCTGGAAAGCCAAGGTGGCGTTTTGCTCGATGTATTCGGGGTGGTTCAAGAGATC
rJMSF019B09- TGCAGCCTGGAAAGCCAAGGTGGCGTTTTGCTCGATGTATTCGGGGTGGTTCAAGAGATC
JMFN010M10+ TGCAGCCTGGAAAGCCAAGGTGGCGTTTTGCTCGATGTATTCGGGGTGGTTCAAGAGATC
JMSF020O01+ GTATTCAGGGTGGCTCAAGAGATC
JMSF032C03+ GGAAAGCCAAGGTGGCGTTTTGCTCGATGTATTCGGGGTGGTTCAAGAGATC
                      ____________________________________________________________
consensus TGCAGCCTGGAAAGCCAAGGTGGCGTTTTGCTCGATGTATTCGGGGTGGTTCAAGAGATC
 
. : . : . : . : . : . :
rJMSF011N15- AACCTTGAGGCCTTCGCCTGCAGCTCCATAATTGAAGTTCCAGTAGAGTGGCANGGCACC
rJMSF029I11- AACCTTGAGGCCTTCGCCTGCAGCTCCATAATTGAAGTTCCAGTAGAGTGGCAAGGCACC
rJMSF032C03- AACCTTGAGGCCTTCGCCTGCAGCTCCATAATTGAAGTTCCAGTAGAGTGGCAAGGCACC
rJMFF037E21- AACCTTGAGGCCTTCGCCTGCAGCTCCATAATTGAAGTTCCAGTA
rJMFF023P21- AACCTTGANGCCTTCGCCTGCAGCTC
rJMFF001G05- AACCTTGAGGCCTTCGCCTGCAGCTCCAT
rJMSF029H07- AACCTTGAGGCCTTCGCCTGCAGCTCCATAATTGAAGTTCCAGTAGA
rJMFF017D20- AACCTTGAGGCCTTCGCCTGCAGCTCCATAATTGAAGTTCCAGTAGAGTGGCAAGGCACC
rJMSF019B09- AACCTTGAGGCCTTCGCCTGCAGCTCCATAATTGAAGTTCCAGTAGAGTGGCAAGGCACC
JMFN010M10+ AACCTTGAGGCCTTCGCCTGCAGCTCCATAATTGAAGTTCCAGTAGAGTGGCAAGGCACC
JMSF029H07+ CTGCAGCTCCATAATTGAAGTTCCAGTAGAGTGGCAAGGCACC
JMSF020O01+ TACTTTGAGTGCTTTACCTGTAGCTCCGTAATTGTAGTTCCAGTAGAGGGGCAAGGCACC
JMSF032C03+ AACCTTGAGGCCTTCGCCTGCAGCTCCATAATTGAAGTTCCAGTAGAGTGGCAAGGCACC
JMFS038D05+ AATTGAAGTTCCAGTAGAGTGGCAAGGCACC
JMFF051J03+ AGTTCCAGTAGAGTGGCAAGGCACC
JMFF009I22+ ACC
                      ____________________________________________________________
consensus AACCTTGAGGCCTTCGCCTGCAGCTCCATAATTGAAGTTCCAGTAGAGTGGCAAGGCACC
 
. : . : . : . : . : . :
rJMSF011N15- GC-GACCATAATACTGAGC
rJMSF029I11- GC-GACCATANTACTGAGCTCC
rJMSF032C03- GC-GACCATAATACTGAG
rJMFF017D20- GC-GACCATAATACTGAGCTCCCGGGGCGCAGGG
rJMSF019B09- GC-GACCATAATACTGAGCTCCCGGGGCGCAGGGATAGGTCAGCTTGTA
JMFN010M10+ GC-GACCATAATACTGAGCTCCCGGGGCGCAGGGATAGGTCAGCTTGTAGTAATCATCGC
JMSF029H07+ GC-GACCATAATACTGAGCTCCCGGGGCGCAGGGATAGGTCAGCTTGTAGTAATCATCGC
JMSF020O01+ AC-GGCCATAATATTGGGCTCCAGGAGAGCATGGGTATGTTAGTTTGTAATAATCATC-A
JMSF032C03+ GC-GACCATAATACTGAGCTCCCGGGGCGCAGGGATAGGTCAGCTTGTAGTAATCATCGC
JMFS038D05+ GC-GACCATAATACTGAGCTCCCGGGGCGCAGGGATAGGTCAGCTTGTAGTAATCATCGC
JMFF051J03+ GCGGACCATAATACTGAGCTCCCGGGGCGCAGGGATAGGTCAGCTTGTAGTAATCATCGC
JMFF013J03+ GGGGCGCAGGGATAGGTCAGCTTGTAGTAATCATCGC
JMFF017D20+ GCGCAGGGATAGGTCAGCTTGTAGTAATCATCGC
JMFF011O19+ GCAGGGATAGGTCAGCTTGTAGTAATCATCGC
JMFF035M09+ GGGCGCAGGGATAGGTCAGCTTGTAGTAATCATCGC
JMFS166C07+ GCAGGGATAGGTCAGCTTGTAGTAATCATCGC
JMSF029I11+ GGGCGCAGGGATAGGTCAGCTTGTAGTAATCGTCGC
JMFF029B05+ CCGGGGCGCAGGGATAGGTCAGCTTGTAGTAATCATCGC
JMFF013O08+ GTAGTAATCATNGC
JMFF009I22+ GC-GACCATAATACTGAGCTCCCGGGGCGCAGGGATAGGTCAGCTTGTAGTAATCATCGC
                      ____________________________________________________________
consensus GC-GACCATAATACTGAGCTCCCGGGGCGCAGGGATAGGTCAGCTTGTAGTAATCATCGC
 
. : . : . : . : . : . :
JMFN010M10+ AGTAGTCTTGGCTAGGACTCATCTCCTTGTTATAACATAGACCCCAAGCCAACGGCCCAC
JMSF029H07+ AGTAGTCTTGGCTAGGACTCATCTCCTTGTTATAACATAGACCCCAAGCCAACGGCCCAC
JMSF020O01+ AATAGTCCTGGCTAGGACTCATCTCCTTGTTATAGCACAGACCCCAAGCCAACGGTCCAC
JMSF032C03+ AGTAGTCTTGGCTAGGACTCATCTCCTTGTTATAACATAGACCCCAAGCCAACGGCCCAC
JMFS038D05+ AGTAGTCTTGGCTAGGACTCATCTCCTTGTTATAACATAGACCCCAAGCCAACGGCCCAC
JMFF051J03+ AGTAGTCTTGGCTAGGACTCATCTCCTTGTTATAACATAGACCCCAAGCCAACGGCCCAC
JMFF013J03+ AGTAGTCTTGGCTAGGACTCATCTCCTTGTTATAACATAGACCCCAAGCCAACGGCCCAC
JMFF017D20+ AGTAGTCTTGGCTAGGACTCATCTCCTTGTTATAACATAGACCCCAAGCCAACGGCCCAC
JMFF046K04+ TGTTATAACATAGACCCCAAGCCAACGGCCCAC
JMFF011O19+ AGTAGTCTNGGCTAGGACTCATCTCCTTGTTATAACATAGACCCCAAGCCAACGGCCCAC
JMFF035M09+ AGTAGTCTTGGCTAGGACTCATCTCCTTGTTATAACATAGACCCCAAGCCAACGGCCCAC
JMFS166C07+ AGTAGTCTTGGCTAGGACTCATCTCCTTGTTATAACATAGACCCCAAGCCAACGGCCCAC
JMSF029I11+ AGTAGTCTTGGCTAGGACTCATCTCCTTGTTATAACATAGACCCCAAGCCAACGGCCCAC
JMFF029B05+ AGTAGTCTTGGCTAGGACTCATCTCCTTGTTATAACATAGACCCCAAGCCAACGGCCCAC
JMFF037E21+ TTGTTATAACATAGACCCCAAGCCAACGGCCCAC
JMFF013O08+ AGTAGTNTNGGNTAGGANTCATNTCNTNGTTATAACATAGACCNCAAGCCAACGGCCCAC
JMFF031M07+ ACGGCCCAC
JMFF022E17+ AACGGCCCAC
JMFF009I22+ AGTAGTCTTGGCTAGGACTCATCTCCTTGTTATAACATAGACCCCAAGCCAACGGCCCAC
JMFF038C18+ CCTTGTTATAACATAGACCCCAAGCCAACGGCCCAC
JMFF023L04+ AC
JMFF001G05+ GCCCAC
                      ____________________________________________________________
consensus AGTAGTCTTGGCTAGGACTCATCTCCTTGTTATAACATAGACCCCAAGCCAACGGCCCAC
 
. : . : . : . : . : . :
JMFN010M10+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMSF029H07+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMSF020O01+ CAGTAGCAACTCCATAGCCACATGAAGTTTTGCTTCCGACATGGGCAAGGAATGCAGCAA
JMSF032C03+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMFS038D05+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMFF051J03+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMFF013J03+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMFF017D20+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMFF046K04+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMFF011O19+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMFF035M09+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMFS166C07+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMSF029I11+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMFF029B05+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMFF037E21+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMFF013O08+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMFF031M07+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMFF022E17+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMFF009I22+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMFF038C18+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMFF023L04+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMFF012G20+ CACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
JMFF001G05+ CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
                      ____________________________________________________________
consensus CAGTAGCCACACCATAACCACATGAAGTTTTGCTGCCGACATGGCCAAGGAAAGCGGCGA
 
. : . : . : . : . : . :
JMFN010M10+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
JMSF029H07+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
JMSF020O01+ GCTCCTTCATCTGCATCGACTTGCCGCCGGTGGTACAGAATCCGAGGGGCTGGAAGGAGG
JMSF032C03+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
JMFS038D05+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
JMFF051J03+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
JMFF013J03+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
JMFF017D20+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
JMFF046K04+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
JMFF011O19+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
JMFF035M09+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
JMFS166C07+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
JMSF029I11+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
JMFF029B05+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
JMFF037E21+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
JMFF013O08+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCNTAGTGGCTGGAAGTCGG
JMFF031M07+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
JMFF022E17+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
JMFF009I22+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
JMFF038C18+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
JMFF023L04+ GCTCACTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
JMSF027A19+ AGTGGNTGGAAGTCGG
JMFF012G20+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
JMFF001G05+ GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
                      ____________________________________________________________
consensus GCTCATTCATCTGCATCTTCTTGCCGCCGGTGGTGGCGAATCCTAGTGGCTGGAAGTCGG
 
. : . : . : . : . : . :
JMFN010M10+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMSF029H07+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMSF020O01+ CGGAAGCGAGGATGAATGAGCGGTAGTCCCAGAAGCCGACGGCGTGAGCGACGGGGGAAT
JMSF032C03+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMFS038D05+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMFF051J03+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMFF013J03+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMFF017D20+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMFF046K04+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMFF011O19+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMFF035M09+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMFS166C07+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMSF029I11+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGAGTGAGCGATGGGGGAAT
JMFF029B05+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMFF037E21+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMFF013O08+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMFF031M07+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMFF022E17+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMFF009I22+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMFF038C18+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMFF023L04+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMSF027A19+ NGGAGGNGAGGATAAATGAGCGGTAATCCCAGAAGCNGACGGCGTGANCGATGGGGGAAT
JMFF012G20+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMFF001G05+ CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
JMFS159E02+ GGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
                      ____________________________________________________________
consensus CGGAGGCGAGGATAAATGAGCGGTAATCCCAGAAGCCGACGGCGTGAGCGATGGGGGAAT
 
. : . : . : . : . : . :
JMFN010M10+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGG
JMSF029H07+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMSF020O01+ TCCTCTTAGAGAAGAGGTTCTCAAACTGGTAGGTCTCGAAGAAATCGGTAATGGTCAAAT
JMSF032C03+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMFS038D05+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMFF051J03+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMFF013J03+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMFF017D20+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMFF046K04+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMFF011O19+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMFF035M09+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMFS166C07+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMSF029I11+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMFF029B05+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMFF037E21+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMFF013O08+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMFF031M07+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMFF022E17+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMFF009I22+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMSF011N15+ TCGGTAATGGTCAAAT
JMFF038C18+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMFF023L04+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMSF027A19+ TCCTCTTGGCGAAGAGATTCTCAAANTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMFF012G20+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMFF001G05+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
JMFS159E02+ TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
                      ____________________________________________________________
consensus TCCTCTTGGCGAAGAGATTCTCAAACTGGTAGGTATCGAAAATGTCGGTAATGGTCAAAT
 
. : . : . : . : . : . :
JMSF029H07+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMSF020O01+ TGCAGCAATATTGGGAGAGGCGATTGCACTCCCAGCCTTTGGCGCACAACTTGGTCCCCT
JMSF032C03+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMFS038D05+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMFF051J03+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGCACCCT
JMFF013J03+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMFF017D20+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMFF046K04+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMFF011O19+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMFF035M09+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMFS166C07+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMSF029I11+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMFF029B05+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMFF037E21+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMFF013O08+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMFF031M07+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMFF022E17+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMFF009I22+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMSF011N15+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMFF038C18+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMFF023L04+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMSF027A19+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMFF012G20+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMFF001G05+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
JMFS159E02+ TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
                      ____________________________________________________________
consensus TACAGCAGAACTTGGAGAGCTTATTACACTCCCACCCTTTGGCGCACATCTTCGTACCCT
 
. : . : . : . : . : . :
JMSF029H07+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMSF020O01+ TCACCTTCTTCACTACAGTCGGCGGCGTCTTCGAAACCTCGCGGTCTCCG
JMSF032C03+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMFS038D05+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMFF051J03+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMFF013J03+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMFF017D20+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMFF046K04+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMFF011O19+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMFF035M09+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMFS166C07+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMSF029I11+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMFF029B05+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMFF037E21+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMFF013O08+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMFF031M07+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMFF022E17+ TCACCTTCTTCACCACTGTCGGCGGCGTCTACGACACCTCTCCGTCTCCGTTCACCGTCG
JMFF009I22+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMSF011N15+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMFF038C18+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMFF023L04+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMSF027A19+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMFF012G20+ TCACCTTCTTCACCA
JMSF019B09+ TGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMFF001G05+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
JMFS159E02+ TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
                      ____________________________________________________________
consensus TCACCTTCTTCACCACTGTCGGCGGCGTCTTCGACACCTCTCCGTCTCCGTTCACCGTCG
 
. : . : . : . : . : . :
JMSF029H07+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMSF032C03+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMFS038D05+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMFF051J03+ TCACGGCAGCCGGCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMFF013J03+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMFF017D20+ TCACGGCAGCCGCCACGAGCATTACCACCGATGCCACCAATTTCAAAGAACCCTCCATTT
JMFF046K04+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMFF011O19+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMFF035M09+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMFS166C07+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMSF029I11+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMFF029B05+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMFF037E21+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMFF013O08+ TCACGGCAGCCGCCACGAGCATTACCACCGATGCCACCAATTTCAAAGAACCCTCCATTT
JMFF031M07+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMFF022E17+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMFF009I22+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMSF011N15+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMFF038C18+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMFF023L04+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMSF027A19+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMSF019B09+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMFF001G05+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
JMFS159E02+ TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
                      ____________________________________________________________
consensus TCACGGCAGCCGCCACGAGCATTACCACCAATGCCACCAATTTCAAAGAACCCTCCATTT
 
. : . : . : . : . : . :
JMSF029H07+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCCTGC
JMSF032C03+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCCTGCG
JMFS038D05+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCTGAATGA
JMFF051J03+ CTTTTTCTCTTGTCTTCAATTTCCCTTGTTGTTCCTGAATGATTTGAGATC
JMFF013J03+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCTGAATGATTTGAGATCTGGGTCAGG
JMFF017D20+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCCTTTT--TTGGGGGAATTAG--AGG
JMFF046K04+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCCT
JMFF011O19+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCCTTTT--TTGGGGGAATT
JMFF035M09+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCCT
JMFS166C07+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCCT
JMSF029I11+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCCT
JMFF029B05+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCCTTTT--TTGGGGGAATTAG--AGG
JMFF037E21+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCTGAATGATTTGAGATCTGGGTCAGG
JMFF013O08+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCCTTTT--TTGGGGGAATTAG--AGG
JMFF031M07+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCTGAATGATTTGAGATCTGGGTCAGG
JMFF022E17+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCC
JMFF009I22+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCTGAATGATTTGAGATCTGGGTCAGG
JMSF011N15+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCCTGC
JMFF038C18+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCCT---------GCGAATGAG--ATG
JMFF023L04+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCCTTTT--TTGGGGGAATT
JMSF027A19+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCC
JMSF019B09+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCCT
JMFF001G05+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCCTTTT--TTGGGGGAATTAG--AGG
JMFS159E02+ CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCCT---------GCGAATGAG--ATG
                      ____________________________________________________________
consensus CTTTTTCTCTTCTCTTCAATTTCCCTTGTTGTTCCCTTTT--TTGGGGGAATTAG--AGG
 
. : . : . : . : . : . :
JMFF013J03+ AAGATGAATTGTGC
JMFF017D20+ AAA
JMFF029B05+ AAA
JMFF037E21+ AAGATGAATTGTGC
JMFF013O08+ AAAGTGT
JMFF031M07+ AAGATGAATTGTGCGG
JMFF009I22+ AAGATGAATTGTGCGG
JMFF038C18+ AAA---AACCCGGTGATTATTTAAGGAGAATGA--AACGA
JMFF001G05+ AAAGTGTAGCGGGTGTTAGATGAAGAATCTCTATCAACGCAAG-GAT
JMFS159E02+ AAA---AACCCGGTGATTATTTAAGGAGAATGA--AACGAAAGTGAAGTGAAAAGAAAGC
                      ____________________________________________________________
consensus AAAATGAATTGTGCGGTTATTTAAGGAGAATGA--AACGAAAGTGATGTGAAAAGAAAGC
 
. : . : . : . : . : . :
JMFS159E02+ CTACTGAATGATTTGAGATCTGGGTCAGGAAGATGAATTGTGCGGGGTTTTTCCTACCTT
                      ____________________________________________________________
consensus CTACTGAATGATTTGAGATCTGGGTCAGGAAGATGAATTGTGCGGGGTTTTTCCTACCTT