Previous Contig 004192:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013J12Sequence616004192 (3)gb:AY099766_15767912e-09Arabidopsis thaliana putative protein (At5g25070) mRNA, complete cds.>gb:AY12889736008824 (2)gb:AY099766_15767918e-04Arabidopsis thaliana putative protein (At5g25070) mRNA, complete cds.>gb:AY12889
JMFS126G07Sequence626004192 (3)gb:AY099766_15767914e-11Arabidopsis thaliana putative protein (At5g25070) mRNA, complete cds.>gb:AY12889
JMFS158H04Sequence622004192 (3)gb:AY099766_15767912e-09Arabidopsis thaliana putative protein (At5g25070) mRNA, complete cds.>gb:AY12889

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS126G07+ GATTAGCGATTTGCTCAGGTGTGTCATTAGAATGAATACCATGAGAA
                      ____________________________________________________________
consensus GATTAGCGATTTGCTCAGGTGTGTCATTAGAATGAATACCATGAGAA
 
. : . : . : . : . : . :
JMFS126G07+ GTTGTATCAGATGAAGAATCGCGATCCTGAGCTGCAGAAATCATGCTGGAGGAATTCGAT
                      ____________________________________________________________
consensus GTTGTATCAGATGAAGAATCGCGATCCTGAGCTGCAGAAATCATGCTGGAGGAATTCGAT
 
. : . : . : . : . : . :
JMFS126G07+ TCTTGATCTTCTTCTTNTTCACCACCACCACCACCACCATCATCATCATCATCATCTTCT
JMFF013J12+ CATCATCATCATCATCATCTTCT
JMFS158H04+ CATCATCATCATCATCATNTTTT
                      ____________________________________________________________
consensus TCTTGATCTTCTTCTTNTTCACCACCACCACCACCACCATCATCATCATCATCATCTTCT
 
. : . : . : . : . : . :
JMFS126G07+ TCTTCTCCTTGCTCTTTTTTCTTCTCTTCTGCTTCCGGGAAACGGGTATCAATATGCGAA
JMFF013J12+ TCTTCTCCTTGCTCTTTTTTCTTCTCTTCTGCTTCCGGGAAACGGGTATCAATATGCGAA
JMFS158H04+ TTTTCTCC-TGCTCNNNTTTCTTCTCTTCTGCTTCCGGGAAACGGGTATCAATATGCGAA
                      ____________________________________________________________
consensus TCTTCTCCTTGCTCTTTTTTCTTCTCTTCTGCTTCCGGGAAACGGGTATCAATATGCGAA
 
. : . : . : . : . : . :
JMFS126G07+ TGGTCATTGGCAGTTGAAGTGGCAATGACTGAATCGGAGGCATGATATCTATCTCTATCT
JMFF013J12+ TGGTCATTGGCAGTTGAAGTGGCAATGACTGAATCGGAGGCATGATATCTATCTCTATCT
JMFS158H04+ TGGTCATTGGCAGTTGAAGTGGCAATGACTGAATCGGAGGCATGATATCTATCTCTATCT
                      ____________________________________________________________
consensus TGGTCATTGGCAGTTGAAGTGGCAATGACTGAATCGGAGGCATGATATCTATCTCTATCT
 
. : . : . : . : . : . :
JMFS126G07+ CTATCTCTACCATATCCAATCCGTAAACCAGCCCTCTTTTTCTTCCGGGTGGAATTCTGG
JMFF013J12+ CTATCTCTACCATATCCAATCCGTAAACCAGCCCTCTTTTTCTTCCGGGTGGAATTCTGG
JMFS158H04+ CTATCTCTACCATATCCAATCCGTAAACCAGCCCTCTTTTTCTTCCGGGTGGAATTCTGG
                      ____________________________________________________________
consensus CTATCTCTACCATATCCAATCCGTAAACCAGCCCTCTTTTTCTTCCGGGTGGAATTCTGG
 
. : . : . : . : . : . :
JMFS126G07+ CGAGAAATTAGCGAGATTGACGATGGATCGGAGTTGGACTTAATATCTTCTAGTTCTAGG
JMFF013J12+ CGAGAAATTAGCGAGATTGACGATGGATCGGAGTTGGACTTAATATCTTCTAGTTCTAGG
JMFS158H04+ CGAGAAATTAGCGAGATTGACGATGGATCGGAGTTGGACTTAATATCTTCTAGTTCTAGG
                      ____________________________________________________________
consensus CGAGAAATTAGCGAGATTGACGATGGATCGGAGTTGGACTTAATATCTTCTAGTTCTAGG
 
. : . : . : . : . : . :
JMFS126G07+ GATTGGGAAGGAGTAACAAGTGTAAGATCAGAGAATAGGTTCTCATCGAGCGGCTGACTA
JMFF013J12+ GATTGGGAAGGAGTAACAAGTGTAAGATCAGAGAATAGGTTCTCATCGAGCGGCTGACTA
JMFS158H04+ GATTGGGAAGGAGTAACAAGTGTAAGATCAGAGAATAGGTTCTCATCGAGCGGCTGACTA
                      ____________________________________________________________
consensus GATTGGGAAGGAGTAACAAGTGTAAGATCAGAGAATAGGTTCTCATCGAGCGGCTGACTA
 
. : . : . : . : . : . :
JMFS126G07+ GGACTCGACTCTGCTATTAACGGCAGCGCCGGCGGTTGATCCGCACCGACATCGAGAGTG
JMFF013J12+ GGACTCGACTCTGCTATTAACGGCAGCGCCGGCGGTTGATCCGCACCGACATCGAGAGTG
JMFS158H04+ GGACTCGACTCTGCTATTAACGGCAGCGCCGGCGGTTGATCCGCACCGACATCGAGAGTG
                      ____________________________________________________________
consensus GGACTCGACTCTGCTATTAACGGCAGCGCCGGCGGTTGATCCGCACCGACATCGAGAGTG
 
. : . : . : . : . : . :
JMFS126G07+ GCAGCGGTGGTGGAGGGTTGCTGGTCTAGGTGTTCAGAAGGATCAAAGAGTACCATCCCC
JMFF013J12+ GCAGCGGTGGTGGAGGGTTGCTGGTCTAGGTGTTCAGAAGGATCAAAGAGTACCATCCCC
JMFS158H04+ GCAGCGGTGGTGGAGGGTTGCTGGTCTAGGTGTTCAGAAGGATCAAAGAGTACCATCCCC
                      ____________________________________________________________
consensus GCAGCGGTGGTGGAGGGTTGCTGGTCTAGGTGTTCAGAAGGATCAAAGAGTACCATCCCC
 
. : . : . : . : . : . :
JMFS126G07+ TCGAACAGTGAGGCCATATCATCGTTCTCTTCCTCCGCT
JMFF013J12+ TCGAACAGTGAGGCCATATCATCGTTCTCTTCCTCCGCTGCCATTTCCAATTTCTAATTT
JMFS158H04+ TCGAACAGTGAGGCCATATCATCGTTCTCTTCCTCCGCTGCCATTTCCAATTTCTAATTT
                      ____________________________________________________________
consensus TCGAACAGTGAGGCCATATCATCGTTCTCTTCCTCCGCTGCCATTTCCAATTTCTAATTT
 
. : . : . : . : . : . :
JMFF013J12+ GATTGCGTTTTTCTTCTTTGTTTGCTAAATAAACACCAGTACACCACGCCAACGCTGCTC
JMFS158H04+ GATTGCGTTTTTCTTCTTTGTTTGCTAAATAAACACCAGTACACCACGCCAACGCTGCTC
                      ____________________________________________________________
consensus GATTGCGTTTTTCTTCTTTGTTTGCTAAATAAACACCAGTACACCACGCCAACGCTGCTC
 
. : . : . : . : . : . :
JMFF013J12+ CAAAGCTTGTCGACACGGCAGGCAGGTTCTGCTTTTTTCTTTTTTTTAGAC
JMFS158H04+ CAAAGCTTGTCGACACGGCAGGCAGGTTCTGCTTTTTTCTTTTTTTTAGACGAGAGCCTT
                      ____________________________________________________________
consensus CAAAGCTTGTCGACACGGCAGGCAGGTTCTGCTTTTTTCTTTTTTTTAGACGAGAGCCTT