Previous Contig 004190:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS027F08Sequence561004190 (7)gb:AP002048_18216633e-52Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXP5.
JMFS099G01Sequence625004190 (7)gb:AP002048_18216631e-71Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXP5.
JMFS106D03Sequence603004190 (7)gb:AP002048_18216633e-59Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXP5.
JMFS153C04Sequence607004190 (7)gb:AP002048_18216631e-58Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXP5.
JMFS155E06Sequence626004190 (7)gb:AP002048_18216639e-66Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXP5.
JMFS158G07Sequence476004190 (7)gb:AP002048_18216635e-36Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXP5.
JMFS165D05Sequence591004190 (7)gb:AP002048_18216632e-64Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXP5.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS099G01+ AGGGAATTTACCGGCGAACC
                      ____________________________________________________________
consensus AGGGAATTTACCGGCGAACC
 
. : . : . : . : . : . :
JMFS165D05+ GATGTCAAGCTCGAACAGAATCTCAAAGTTTTTGAACTTCTTCGGGATTG
JMFS099G01+ GATTGTTGCTGATGTCAAGCTCGAACAGAATCTTCAAGTTTTTGAACTTCTTCGGGATTG
JMFS155E06+ GATGTCAAGCTCGAACAGAATCTTCAAGTTTTTGAACTTCTTCGGGATTG
JMFS106D03+ TCGGGATTG
JMFS153C04+ CGGGATTG
                      ____________________________________________________________
consensus GATTGTTGCTGATGTCAAGCTCGAACAGAATCTTCAAGTTTTTGAACTTCTTCGGGATTG
 
. : . : . : . : . : . :
JMFS165D05+ TGCCGCAGAAGCGGTTGGAATTGATGTGGAAAACCCCTAGATCTGCGAGCAGGCCGAGCT
JMFS099G01+ TGCCGCAGAAGCGGTTGGAATTGATGTGGAAAACCCCTAGATCTGCGAGCAGGCCGAGCT
JMFS155E06+ TGCCGCAGAAGCGGTTGGAATTGATGTGGAAAACCCCTAGATCTGCGAGCAGGCCGAGCT
JMFS027F08+ TGTGGAAAACCCCTAGATCTGCGAGCAGGCCGAGCT
JMFS106D03+ TGCCGCAGAAGCGGTTGGAATTGATGTGGAAAACCCCTAGATCTGCGAGCAGGCCGAGCT
JMFS153C04+ TGCCGCAGAAGCGGTTGGAATTGATGTGGAAAACCCCTAGATCTGCGAGCAGGCCGAGCT
                      ____________________________________________________________
consensus TGCCGCAGAAGCGGTTGGAATTGATGTGGAAAACCCCTAGATCTGCGAGCAGGCCGAGCT
 
. : . : . : . : . : . :
JMFS165D05+ CCTCCGGGAGGTATCCGGCAATGTCGTCGTGGTTGAGGTCAATGCTGGCGACGGTCCGAA
JMFS099G01+ CCTCCGGGAGGTATCCGGCAATGTCGTCGTGGTTGAGGTCAATGCTGGCGACGGTCCGAA
JMFS155E06+ CCTCCGGGAGGTATCCGGCAATGTCGTCGTGGTTGAGGTCAATGCTGGCGACGGTCCGAA
JMFS027F08+ CCTCCGGGAGGTATCCGGCAATGTCGTCGTGGTTGAGGTCAATGCTGGCGACGGTCCGAA
JMFS106D03+ CCTCCGGGAGGTATCCGGCAATGTCGTCGTGGTTGAGGTCAATGCTGGCGACGGTCCGAA
JMFS153C04+ CCTCCGGGAGGTATCCGGCAATGTCGTCGTGGTTGAGGTCAATGCTGGCGACGGTCCGAA
                      ____________________________________________________________
consensus CCTCCGGGAGGTATCCGGCAATGTCGTCGTGGTTGAGGTCAATGCTGGCGACGGTCCGAA
 
. : . : . : . : . : . :
JMFS165D05+ TTTTAGGATTATCCGGCGCCGGCGCGCAGAAGACTCCGGTGTAGTTGCACACGTCTGACC
JMFS099G01+ TTTTAGGATTATCCGGCGCCGGCGCGCAGAAGACTCCGGTGTAGTTGCACACGTCTGACC
JMFS155E06+ TTTTAGGATTATCCGGCGCCGGCGCGCAGAAGACTCCGGTGTAGTTGCACACGTCTGACC
JMFS027F08+ TTTTAGGATTATCCGGCGCCGGCGCGCAGAAGACTCCGGTGTAGTTGCACACGTCTGACC
JMFS106D03+ TTTTAGGATTATCCGGCGCCGGCGCGCAGAAGACTCCGGTGTAGTTGCACACGTCTGACC
JMFS153C04+ TTTTAGGATTATCCGGCGCCGGCGCGCAGAAGACTCCGGTGTAGTTGCACACGTCTGACC
JMFS158G07+ AGGATTATCCGGCGCCGGCGCGCAGAAGACTCCGGTGTAGTTGCACACGTCTGACC
                      ____________________________________________________________
consensus TTTTAGGATTATCCGGCGCCGGCGCGCAGAAGACTCCGGTGTAGTTGCACACGTCTGACC
 
. : . : . : . : . : . :
JMFS165D05+ CGACCCAATCCGAAGTGGTGTTCCGCGGATCCGAAATGATGGCCTGCTTCCAGGCCTGGA
JMFS099G01+ CGACCCAATCCGAAGTGGTGTTCCGCGGATCCGAAATGATGGCCTGCTTCCAGGCCTGGA
JMFS155E06+ CGACCCAATCCGAAGTGGTGTTCCGCGGATCCGAAATGATGGCCTGCTTCCAGGCCTGGA
JMFS027F08+ CGACCCAATCCGAAGTGGTGTTCCGCGGATCCGAAATGATGGCCTGCTTCCAGGCCTGGA
JMFS106D03+ CGACCCAATCCGAAGTGGTGTTCCGCGGATCCGAAATGATGGCCTGCTTCCAGGCCTGGA
JMFS153C04+ CGACCCAATCCGAAGTGGTGTTCCGCGGATCCGAAATGATGGCCTGCTTCCAGGCCTGGA
JMFS158G07+ CGACCCAATCCGAAGTGGTGTTCCGCGGATCCGAAATGATGGCCTGCTTCCAGGCCTGGA
                      ____________________________________________________________
consensus CGACCCAATCCGAAGTGGTGTTCCGCGGATCCGAAATGATGGCCTGCTTCCAGGCCTGGA
 
. : . : . : . : . : . :
JMFS165D05+ GAGCGATGTAAGCATTCCGGATCCTGTCGTTCTCGAACGTCAACGACGGGTCAACCGTGA
JMFS099G01+ GAGCGATGTAAGCATTCCGGATCCTGTCGTTCTCGAACGTCAACGACGGGTCAACCGTGA
JMFS155E06+ GAGCGATGTAAGCATTCCGGATCCTGTCGTTCTCGAACGTCAACGACGGGTCAACCGTGA
JMFS027F08+ GAGCGATGTAAGCATTCCGGATCCTGTCGTTCTCGAACGTCAACGACGGGTCAACCGTGA
JMFS106D03+ GAGCGATGTAAGCATTCCGGATCCTGTCGTTCTCGAACGTCAACGACGGGTCAACCGTGA
JMFS153C04+ GAGCGATGTAAGCATTCCGGATCCTGTCGTTCTCGAACGTCAACGGCGGGTCAACCGTGA
JMFS158G07+ GAGCGATGTAAGCATTCCGGATCCTGTCGTTCTCGAACGTCAACGACGGGTCAACCGTGA
                      ____________________________________________________________
consensus GAGCGATGTAAGCATTCCGGATCCTGTCGTTCTCGAACGTCAACGACGGGTCAACCGTGA
 
. : . : . : . : . : . :
JMFS165D05+ CCCGCTCGCCGCGGTCGCCGAACTCGTCGCGGTAGTACAGCAGCTGGCGGCGCTGGATGT
JMFS099G01+ CCCGCTCGCCGCGGTCGCCGAACTCGTCGCGGTAGTACAGCAGCTGGCGGCGCTGGATGT
JMFS155E06+ CCCGCTCGCCGCGGTCGCCGAACTCGTCGCGGTAGTACAGCAGCTGGCGGCGCTGGATGT
JMFS027F08+ CCCGCTCGCCGCGGTCGCCGAACTCGTCGCGGTAGTACAGCAGCTGGCGGCGCTGGATGT
JMFS106D03+ CCCGCTCGCCGCGGTCGCCGAACTCGTCGCGGTAGTACAGCAGCTGGCGGCGCTGGATGT
JMFS153C04+ CCCGCTCGCCGCGGTCGCCGAACTCGTCGCGGTAGTACAGCAGCTGGCGGCGCTGGATGT
JMFS158G07+ CCCGCTCGCCGCGGTCGCCGAACTCGTCGCGGTAGTACAGCAGCTGGCGGCGCTGGATGT
                      ____________________________________________________________
consensus CCCGCTCGCCGCGGTCGCCGAACTCGTCGCGGTAGTACAGCAGCTGGCGGCGCTGGATGT
 
. : . : . : . : . : . :
JMFS165D05+ AGTGGACCTCGGAGTCCGACAATGGGCCATTATCGGAAACCCTGAAAGCGGCGGCGGAGG
JMFS099G01+ AGTGGACCTCGGAGTCCGACAATGGGCCATTATCGGAAACCCTGAAAGCGGCGGCGGAGG
JMFS155E06+ AGTGGACCTCGGAGTCCGACAATGGGCCATTATCGGAAACCCTGAAAGCGGCGGCGGAGG
JMFS027F08+ AGTGGACCTCGGAGTCCGACAATGGGCCATTATCGGAAACCCTGAAAGCGGCGGCGGAGG
JMFS106D03+ AGTGGACCTCGGAGTCCGACAATGGGCCATTATCGGAAACCCTGAAAGCGGCGGCGGAGG
JMFS153C04+ AGTGGACCTCGGAGTCCGACAATGGGCCATTATCGGAAACCCTGAAAGCGGCGGCGGAGG
JMFS158G07+ AGTGGACCTCGGAGTCCGACAATGGGCCATTATCGGAAACCCTGAAAGCGGCGGCGGAGG
                      ____________________________________________________________
consensus AGTGGACCTCGGAGTCCGACAATGGGCCATTATCGGAAACCCTGAAAGCGGCGGCGGAGG
 
. : . : . : . : . : . :
JMFS165D05+ CAGAAAACGAGAATGCGAGTAAAACAGAAGCTAAAAAAAAGCAGAAAGATGGAGCTCCGT
JMFS099G01+ CAGAAAACGAGAATGCGAGTAAAACAGAAGCTAAAAAAAAGCAGAAAGATGGAGCTCCGT
JMFS155E06+ CAGAAAACGAGAATGCGAGTAAAACAGAAGCTAAAAAAAAGCAGAAAGATGGAGCTCCGT
JMFS027F08+ CAGAAAACGAGAATGCGAGTAAAACAGAAGCTAAAAAAAAGCAGAAAGATGGAGCTCCGT
JMFS106D03+ CAGAAAACGAGAATGCGAGTAAAACAGAAGCTAAAAAAAAGCAGAAAGATGGAGATCCGT
JMFS153C04+ CAGAAAACGAGAATGCGAGTAAAACAGAAGCTAAAAAAAAGCAGAAAGATGGAGCTCCGT
JMFS158G07+ CAGAAAACGAGAATGCGAGTAAAACAGAAGCTAAAAAAAAGCAGAAAGATGGAGCTCCGT
                      ____________________________________________________________
consensus CAGAAAACGAGAATGCGAGTAAAACAGAAGCTAAAAAAAAGCAGAAAGATGGAGCTCCGT
 
. : . : . : . : . : . :
JMFS165D05+ TTTGCCTCATGTCAGCGCAGACATCAGTGGAAGCTTCAGGGAGGTTTGTTAATGGAGAAA
JMFS099G01+ TTTGCCTCATGTCAGCGCAGACATCAGTGGAAGCTTCAGGGAGGTTTGTTAATGGAGAAA
JMFS155E06+ TTTGCCTCATGTCAGCGCAGACATCAGTGGAAGCTTCAGGGAGGTTTGTTAATGGAGAAA
JMFS027F08+ TTTGCCTCATGTCAGCGCAGACATCAGTGGAAGCTTCAGGGAGGTTTGTTAATGGAGAAA
JMFS106D03+ TTTGCCTCATGTCAGCGCAGACATCAGTGGAAGCTTCAGGGAGGTTTGTTAATGGAGAAA
JMFS153C04+ TTTGCCTCATGTCAGCGCAGACATCAGTGGAAGCTTCAGGGAGGTTTGTTAATGGAGAAA
JMFS158G07+ TTTGCCTCATGTCAGCGCAGACATCAGTGGAAGCTTCAGGGAGGTTTGTTAATGGAGAAA
                      ____________________________________________________________
consensus TTTGCCTCATGTCAGCGCAGACATCAGTGGAAGCTTCAGGGAGGTTTGTTAATGGAGAAA
 
. : . : . : . : . : . :
JMFS165D05+ G
JMFS099G01+ GAGAG
JMFS155E06+ GAGAGGAAATGTGGGTGGGAGAGATAGAGAGAG
JMFS027F08+ GAGAGGAAATGTGGGTGGGAGAGATAGAGAGAGAGAGAGAGAGAG
JMFS106D03+ GAGAGGAAATGTGGGTGGGAGAGATAGAGAGAGAGAGAGAGAGAG
JMFS153C04+ GAGAGGAAATGTGGGTGGGAGAGATAGAGAGAGAGAGAGAGAGAG
JMFS158G07+ GAGAGGAAATGTGGGTGGGAGAGATAGAGAGAGAGAGAGAGAGAGGAGAGAGATCTGAAG
                      ____________________________________________________________
consensus GAGAGGAAATGTGGGTGGGAGAGATAGAGAGAGAGAGAGAGAGAGGAGAGAGATCTGAAG