Previous Contig 004187:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS121H10Sequence541004187 (2)gb:AP002544_18226707e-06Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MBL20.
JMFS158D11Sequence249004187 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS121H10+ CCTAATCGAACATTGTTAAATG
                      ____________________________________________________________
consensus CCTAATCGAACATTGTTAAATG
 
. : . : . : . : . : . :
JMFS121H10+ GGGTATACCTTGTCACAGGAAATTGATATGCAGTTTAGTTGATGTGTTTATGTTTGTTTC
                      ____________________________________________________________
consensus GGGTATACCTTGTCACAGGAAATTGATATGCAGTTTAGTTGATGTGTTTATGTTTGTTTC
 
. : . : . : . : . : . :
JMFS121H10+ ATAGTAATCCAATTTGTAATGTTGACCAGCATTGTCACTGAAACACTCCATCTAACCAAG
                      ____________________________________________________________
consensus ATAGTAATCCAATTTGTAATGTTGACCAGCATTGTCACTGAAACACTCCATCTAACCAAG
 
. : . : . : . : . : . :
JMFS121H10+ GTTTCATATTCTCACCATGTCTGAGCTATTTTCTTACCTATTGATTGGTTTTGTACTTCA
                      ____________________________________________________________
consensus GTTTCATATTCTCACCATGTCTGAGCTATTTTCTTACCTATTGATTGGTTTTGTACTTCA
 
. : . : . : . : . : . :
JMFS121H10+ TCGTTCCACCAATATCCGGCGCTGAATATAAGAACAAATGATCCAACCCAATTGTCAGCT
                      ____________________________________________________________
consensus TCGTTCCACCAATATCCGGCGCTGAATATAAGAACAAATGATCCAACCCAATTGTCAGCT
 
. : . : . : . : . : . :
JMFS121H10+ TACCAGTGGATCCTGTTGAGTCGGAACCACTTTTCAATTTCTTTGGTGCATTTACCTGCA
JMFS158D11- TTACCTGCA
                      ____________________________________________________________
consensus TACCAGTGGATCCTGTTGAGTCGGAACCACTTTTCAATTTCTTTGGTGCATTTACCTGCA
 
. : . : . : . : . : . :
JMFS121H10+ GGATCACCAGGAAGCACATTGTAATCCTCTTTGGTTGGTTTTTAGCTTGGAAGTTAGTGG
JMFS158D11- GGATCACCAGGAAGCACATTGTAATCCTCTTTGGTTGGTTTTTAGCTTGGAAGTTAGTGG
                      ____________________________________________________________
consensus GGATCACCAGGAAGCACATTGTAATCCTCTTTGGTTGGTTTTTAGCTTGGAAGTTAGTGG
 
. : . : . : . : . : . :
JMFS121H10+ GCACTTGTCAACTGGGAAAGTTCAAACTGATAAGTTTGAGATTATATCAAGGAACGTAAA
JMFS158D11- GCACTTGTCAACTGGGAAAGTTCAAACTGATAAGTTTGAGATTATATCAAGGAACGTAAA
                      ____________________________________________________________
consensus GCACTTGTCAACTGGGAAAGTTCAAACTGATAAGTTTGAGATTATATCAAGGAACGTAAA
 
. : . : . : . : . : . :
JMFS121H10+ TCACACATTGTTTAGTTTTTGGATTGGCACATTGTTTAGTTTTTGGGTTGGTTTTTGTTG
JMFS158D11- TCACACATTGTTTAGTTTTTGGATTGGCACATTGTTTAGTTTTTGGGTTGGTTTTTGTTG
                      ____________________________________________________________
consensus TCACACATTGTTTAGTTTTTGGATTGGCACATTGTTTAGTTTTTGGGTTGGTTTTTGTTG
 
. : . : . : . : . : . :
JMFS121H10+ AGTACATGTAGAGAAGATGAGAGAGGGAAGAAGAAAATG
JMFS158D11- AGTACATGGAGAGAAGATGAGAGAGGGAAGAAGAAAATGAAAAAAAAAAAAGAGTTTAAC
                      ____________________________________________________________
consensus AGTACATGTAGAGAAGATGAGAGAGGGAAGAAGAAAATGAAAAAAAAAAAAGAGTTTAAC