Previous Contig 004186:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS124B06Sequence572004186 (2)gb:ATAC022287_15437639e-53Arabidopsis thaliana chromosome III BAC T27C4 genomic sequence, complete sequenc
JMFS158D04Sequence434004186 (2)gb:ATAC022287_15437631e-29Arabidopsis thaliana chromosome III BAC T27C4 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS124B06+ TTGGTAGTCAGATGCAATTGCACCAGAAGACACTGCTGCAACATCAGGTA
                      ____________________________________________________________
consensus TTGGTAGTCAGATGCAATTGCACCAGAAGACACTGCTGCAACATCAGGTA
 
. : . : . : . : . : . :
JMFS124B06+ TCTGTCGTTTTACTTCATTCAACAAGATGAACATGTCTTCAACTTCATCACCAGGAGTCA
                      ____________________________________________________________
consensus TCTGTCGTTTTACTTCATTCAACAAGATGAACATGTCTTCAACTTCATCACCAGGAGTCA
 
. : . : . : . : . : . :
JMFS124B06+ AGCTGTAGCTAAGGCCATAATTCCTTGTGGATCCTTTTATTCTCCTTCGAAATAATGGCA
JMFS158D04+ TCGAAATAATGGCA
                      ____________________________________________________________
consensus AGCTGTAGCTAAGGCCATAATTCCTTGTGGATCCTTTTATTCTCCTTCGAAATAATGGCA
 
. : . : . : . : . : . :
JMFS124B06+ CTCCCATGCATGTTGCATAGCTGACAACTATCTGATGCCCAACAGTTTGATACATGTAGC
JMFS158D04+ CTCCCATGCATGTTGCATAGCTGACAACTATCTGATGCCCAACAGTTTGATACATGTAGC
                      ____________________________________________________________
consensus CTCCCATGCATGTTGCATAGCTGACAACTATCTGATGCCCAACAGTTTGATACATGTAGC
 
. : . : . : . : . : . :
JMFS124B06+ TGTCAAGCTCGTCCTGTGCATCATCAGCCGGCATTAAATTCGCCAATGCAACTATCTCGT
JMFS158D04+ TGTCAAGCTCGTCCTGTGCATCATCAGCCGGCATTAAATTCGCCAATGCAACTATCTCGT
                      ____________________________________________________________
consensus TGTCAAGCTCGTCCTGTGCATCATCAGCCGGCATTAAATTCGCCAATGCAACTATCTCGT
 
. : . : . : . : . : . :
JMFS124B06+ GGCCGTACTGTATGCATTTCATCATAGCATAGCAGCTGTCTTTGCCGCCGCTAACTAAAG
JMFS158D04+ GGCCGTACTGTATGCATTTCATCATAGCATAGCAGCTGTCTTTGCCGCCGCTAACTAAAG
                      ____________________________________________________________
consensus GGCCGTACTGTATGCATTTCATCATAGCATAGCAGCTGTCTTTGCCGCCGCTAACTAAAG
 
. : . : . : . : . : . :
JMFS124B06+ CCACCACCTTCATAGTTCACAGCTGATGAGTTTGTCGGATATGAAAATGGTGGCGCCGAA
JMFS158D04+ CCACCACCTTCATAGTTCACAGCTGATGAGTTTGTCGGATATGAAAATGGTGGCGCCGCA
                      ____________________________________________________________
consensus CCACCACCTTCATAGTTCACAGCTGATGAGTTTGTCGGATATGAAAATGGTGGCGCCGCA
 
. : . : . : . : . : . :
JMFS124B06+ ATGGTAGGGTTTTACGAGCAGGAAGCTTCAGTTTCATTGGTTGTCTCCATTTGACTCCTC
JMFS158D04+ ATGGTAGGGTTTTACGAGCAGGAAGCTTCAGTTTCATTGGTTGTCTCCATTTGACTCCTC
                      ____________________________________________________________
consensus ATGGTAGGGTTTTACGAGCAGGAAGCTTCAGTTTCATTGGTTGTCTCCATTTGACTCCTC
 
. : . : . : . : . : . :
JMFS124B06+ TTGTGCATTTGCAGGAACTGGAAGTCACCGTTCCCGCCCGTCGGCCGTCGCTGACTCGCT
JMFS158D04+ TTGTGCATTTGCAGGAACTGGAAGTCACCGTTCCCGCCCGTCGGCCGTCGCTGACTCGCT
                      ____________________________________________________________
consensus TTGTGCATTTGCAGGAACTGGAAGTCACCGTTCCCGCCCGTCGGCCGTCGCTGACTCGCT
 
. : . : . : . : . : . :
JMFS124B06+ GCTTAACCTGCGTTCCAGACGTCCTGCGTTGCTGCGTGGCTG
JMFS158D04+ GCTTAACCTGCGTTCCAGACGTCCTGCGTTGCTGCGTGGCTGGCTGGATAGTGGAGAGTG
                      ____________________________________________________________
consensus GCTTAACCTGCGTTCCAGACGTCCTGCGTTGCTGCGTGGCTGGCTGGATAGTGGAGAGTG