Previous Contig 004180:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFS157F12Sequence473004180 (2)gb:OSJN00174_16961967e-35Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0058K23, complete seque
JMFS162B06Sequence594004180 (2)gb:OSJN00174_16961964e-51Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0058K23, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS162B06+ TACAGACCTGCTGTAAAACTCTGAAACAGCCATTATGAGGTTGAACATCACAGAGTC
                      ____________________________________________________________
consensus TACAGACCTGCTGTAAAACTCTGAAACAGCCATTATGAGGTTGAACATCACAGAGTC
 
. : . : . : . : . : . :
JMFS162B06+ CCCTACCAATGCATAAATTACTCCAAACCTAACAAACCACCGAGTCTCTCGGATGTAGAC
                      ____________________________________________________________
consensus CCCTACCAATGCATAAATTACTCCAAACCTAACAAACCACCGAGTCTCTCGGATGTAGAC
 
. : . : . : . : . : . :
JMFS162B06+ TTTTGTTTCGATGCCAATCATCACCACCATAGAGAGCCATGCAAGAGCTTCAATGGTTAA
JMFS157F12+ TCGATGCCAATCATCACCACCATAGAGAGCCATGCAAGAGCTTCAATGGTTAA
                      ____________________________________________________________
consensus TTTTGTTTCGATGCCAATCATCACCACCATAGAGAGCCATGCAAGAGCTTCAATGGTTAA
 
. : . : . : . : . : . :
JMFS162B06+ GGAAATTATCTCATATGGAGCGATACCAGTCTGCCCATCAACATTTAAGACAGAGATTCC
JMFS157F12+ GGAAATTATCTCATATGGAGCGATACCAGTCTGCCCATCAACATTTAAGACAGAGATTCC
                      ____________________________________________________________
consensus GGAAATTATCTCATATGGAGCGATACCAGTCTGCCCATCAACATTTAAGACAGAGATTCC
 
. : . : . : . : . : . :
JMFS162B06+ CATGACCAATCTATATAAGGGTTCACCGGTACAATAAGCAGCCAGCAAACCCAACACATA
JMFS157F12+ CATGACCAATCTATATAAGGGTTCACCGGTACAATAAGCAGCCAGCAAACCCAACACATA
                      ____________________________________________________________
consensus CATGACCAATCTATATAAGGGTTCACCGGTACAATAAGCAGCCAGCAAACCCAACACATA
 
. : . : . : . : . : . :
JMFS162B06+ GTTGTAGTATTTCGACTTTAAACAGAACCTCTGGACCGTGAAGTCTTTCTTTGTCTTCCA
JMFS157F12+ GTTGTAGTATTTCGACTTTAAACAGAACCTCTGGACCGTGAAGTCTTTCTTTGTCTTCCA
                      ____________________________________________________________
consensus GTTGTAGTATTTCGACTTTAAACAGAACCTCTGGACCGTGAAGTCTTTCTTTGTCTTCCA
 
. : . : . : . : . : . :
JMFS162B06+ TATTCGGTATAGGCACAGCACCAAAATCAGAAGATGAGAAATAGATATCACCAGAGTGTC
JMFS157F12+ TATTCGGTATAGGCACAGCACCAAAATCAGAAGATGAGAAATAGATATCACCAGAGCGTC
                      ____________________________________________________________
consensus TATTCGGTATAGGCACAGCACCAAAATCAGAAGATGAGAAATAGATATCACCAGAGTGTC
 
. : . : . : . : . : . :
JMFS162B06+ GGTTACACATGGGGTGTAAACTCCAAATGCATTCTCCACCGCGGTTGACCACACCCCATT
JMFS157F12+ GGTTACACATGGGGTGTAAACTCCAAATGCATTCTCCACCGCGGTTGACCACACCCCATT
                      ____________________________________________________________
consensus GGTTACACATGGGGTGTAAACTCCAAATGCATTCTCCACCGCGGTTGACCACACCCCATT
 
. : . : . : . : . : . :
JMFS162B06+ CTTCACTGGCTGACAATACCAATCCAATGGCTTGATAGCCATCTTTAGTCACTTTAACAC
JMFS157F12+ CTTCACTGGCTGACAATACCAATCCAATGGCTTGATAGCCATCTTTAGTCACTTTAACAC
                      ____________________________________________________________
consensus CTTCACTGGCTGACAATACCAATCCAATGGCTTGATAGCCATCTTTAGTCACTTTAACAC
 
. : . : . : . : . : . :
JMFS162B06+ CACTACTGTACCCTTTATGGTCTCATTGACAGTATCCCAAATCCTTATTTGCTTCTC
JMFS157F12+ CACTACTGTACCCTTTATGGTCTCATTGACAGTATCCCAAATCCTTATTTGCTTCTCTTC
                      ____________________________________________________________
consensus CACTACTGTACCCTTTATGGTCTCATTGACAGTATCCCAAATCCTTATTTGCTTCTCTTC