Previous Contig 004178:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF036E20Sequence567004178 (5)gb:OSJN00292_16980722e-25Oryza sativa genomic DNA, chromosome 4, BAC clone: P0076O17, complete sequence.659021487gb:OSJN00175_16962112e-12Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0064D20, complete seque
JMFF037K03Sequence578004178 (5)gb:OSJN00292_16980724e-24Oryza sativa genomic DNA, chromosome 4, BAC clone: P0076O17, complete sequence.697021525gb:AY133723_15815432e-35Arabidopsis thaliana auxin response factor 1 (At1g59750) mRNA, complete cds.
JMFS157D02Sequence629004178 (5)gb:AY323908_15993670.003Arabidopsis thaliana chromosome IV poly(A) polymerase mRNA, complete cds.
JMSF033B22Sequence682004178 (5)gb:AY133723_15815431e-06Arabidopsis thaliana auxin response factor 1 (At1g59750) mRNA, complete cds.625004178 (5)gb:OSJN00175_16962113e-09Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0064D20, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF033B22- GATGGCTTCTAAATCTTACAATTGCACACATACACTAAAGAAAGCAATGAAAT
                      ____________________________________________________________
consensus GATGGCTTCTAAATCTTACAATTGCACACATACACTAAAGAAAGCAATGAAAT
 
. : . : . : . : . : . :
rJMSF033B22- TAAGCAGGCAAGTGAAGCTACTCACAGATAATTAATCAAAATCATGTCATTGATGGAATA
                      ____________________________________________________________
consensus TAAGCAGGCAAGTGAAGCTACTCACAGATAATTAATCAAAATCATGTCATTGATGGAATA
 
. : . : . : . : . : . :
rJMSF033B22- AGGAAGACTTCCGCTTAAATTATTATATGCAAGATTCCGTAAGCCAGGTGGTTAACCATT
                      ____________________________________________________________
consensus AGGAAGACTTCCGCTTAAATTATTATATGCAAGATTCCGTAAGCCAGGTGGTTAACCATT
 
. : . : . : . : . : . :
rJMSF033B22- GGACCATAAGAGAGTTTAGGTGATGGGAAGAGATCTGTCCCACGGGATGTATCACAATAT
JMSF033B22+ GGGATGTATCACAATAT
                      ____________________________________________________________
consensus GGACCATAAGAGAGTTTAGGTGATGGGAAGAGATCTGTCCCACGGGATGTATCACAATAT
 
. : . : . : . : . : . :
rJMSF033B22- GAGAACGATAGGGGAGAATCAACAGGTGATTTCCATGTCCCTAGCGCAGAAAATTCAGAT
JMSF033B22+ GAGAACGATAGGGGAGAATCAACAGGTGATTTCCATGTCCCTAGCGCAGAAAATTCAGAT
                      ____________________________________________________________
consensus GAGAACGATAGGGGAGAATCAACAGGTGATTTCCATGTCCCTAGCGCAGAAAATTCAGAT
 
. : . : . : . : . : . :
rJMSF033B22- ACCGATGGACGTAAATTTGCTGGGTGTGCACGCTTGTTCCTTTGTGGAGGCTGGAGCGTT
JMSF033B22+ ACCGATGGACGTAAATTTGCTGGGTGTGCACGCTTGTTCCTTTGTGGAGGCTGGAGCGTT
                      ____________________________________________________________
consensus ACCGATGGACGTAAATTTGCTGGGTGTGCACGCTTGTTCCTTTGTGGAGGCTGGAGCGTT
 
. : . : . : . : . : . :
rJMSF033B22- TGAGGTGTCGAAGTGACAAGTGCTTCTATCTCCCATGGTGAAACCCGTAACTCTTTCAGC
JMSF033B22+ TGAGGTGTCGAAGTGACAAGTGCTTCTATCTCCCATGGTGAAACCCGTAACTCTTTCAGC
                      ____________________________________________________________
consensus TGAGGTGTCGAAGTGACAAGTGCTTCTATCTCCCATGGTGAAACCCGTAACTCTTTCAGC
 
. : . : . : . : . : . :
rJMSF033B22- ATATAATGGATTGCCAGCAAGGGTTCTGATTCTACCATTTGTTTGTGGTAGGCTTTCTGT
JMFF037K03+ CCAGCAAGGGTTCTGATTCTACCATTTGTTTGTGGTATGCTTTCTGT
JMFF036E20+ CCAGCAAGGGTTCTGATTCTACCATTTGTTTGTGGTATGCTTTCTGT
JMSF033B22+ ATATAATGGATTGCCAGCAAGGGTTCTGATTCTACCATTTGTTTGTGGTAGGCTTTCTGT
                      ____________________________________________________________
consensus ATATAATGGATTGCCAGCAAGGGTTCTGATTCTACCATTTGTTTGTGGTAGGCTTTCTGT
 
. : . : . : . : . : . :
rJMSF033B22- TAGTGAACCGTTAGATTTCTGGGATGAACCATTAGCACTCTGAGAAACATGGAGCCTTCC
JMFF037K03+ TAGTGAACCGTTAGATTTCTAGGATGAACCATTAGCACTCTGAGAAACATGGAGCCTTCC
JMFF036E20+ TAGTGAACCGTTAGATTTCTAGGATGAACCATTAGCACTCTGAGAAACATGGAGCCTTCC
JMSF033B22+ TAGTGAACCGTTAGATTTCTGGGATGAACCATTAGCACTCTGAGAAACATGGAGCCTTCC
                      ____________________________________________________________
consensus TAGTGAACCGTTAGATTTCTGGGATGAACCATTAGCACTCTGAGAAACATGGAGCCTTCC
 
. : . : . : . : . : . :
rJMSF033B22- TCTATCGCCGTCGAAATGATGCATGTATGGCTTTCCTGGTTTCAATTCAACTC-CTTTTT
JMFF037K03+ TCTATCGCCGTCGAAATGATGAGTGTATGGCTTTCCTGGTTTCAATTCAACTC-TTTTTT
JMFF036E20+ TCTATCGCCGTCGAAATGATGAGTGTATGGCTTTCCTGGTTTCAATTCAACTCTTTTTTT
JMSF033B22+ TCTATCGCCGTCGAAATGATGCATGTATGGCTTTCCTGGTTTCAATTCAACTC-CTTTTT
                      ____________________________________________________________
consensus TCTATCGCCGTCGAAATGATGCATGTATGGCTTTCCTGGTTTCAATTCAACTC-CTTTTT
 
. : . : . : . : . : . :
rJMSF033B22- GGAGAGCGTACA
JMFF037K03+ GGAGAGCGTACA
JMFF036E20+ GGAGAGCGTACA
JMSF033B22+ GGAGAGCGTACAGCGGCGTCCGTACTGCGATGGCGAGCTGAGCTTGTAGAGCGGAGGCGT
                      ____________________________________________________________
consensus GGAGAGCGTACAGCGGCGTCCGTACTGCGATGGCGAGCTGAGCTTGTAGAGCGGAGGCGT
 
. : . : . : . : . : . :
JMSF033B22+ CGCGGCGGCGACCTTGGGCGGCAGTGGCGGGGACGTCGATCGGCAGTGGCGGGGACGTAG
                      ____________________________________________________________
consensus CGCGGCGGCGACCTTGGGCGGCAGTGGCGGGGACGTCGATCGGCAGTGGCGGGGACGTAG
 
. : . : . : . : . : . :
JMSF033B22+ ATCGGCGATGGAAGACGGAATGGTGATGGACGGGAAGATGGAGAGCGTGGACGGCGAGGA
JMFS157D02- GATGGACGGGAAGATGGAGAGCGTGGACGGCGGGGA
                      ____________________________________________________________
consensus ATCGGCGATGGAAGACGGAATGGTGATGGACGGGAAGATGGAGAGCGTGGACGGCGGGGA
 
. : . : . : . : . : . :
JMSF033B22+ TGATGGAGACTGATGGACGGCGTCGGACGGCGGAGACTGATGGACGGCGTCGGA
JMFS157D02- CGATGGAGAGTG-TGGACGGCGTCGGACGGCGGTGACTGATGGACGGCGTCGGAGCAGAG
                      ____________________________________________________________
consensus TGATGGAGAGTGATGGACGGCGTCGGACGGCGGTGACTGATGGACGGCGTCGGAGCAGAG
 
. : . : . : . : . : . :
JMFS157D02- CTGATGGAGATGGACGGCGTCAGACGCGATCTGATACAGAGCTGAATGATACAGATCGAG
                      ____________________________________________________________
consensus CTGATGGAGATGGACGGCGTCAGACGCGATCTGATACAGAGCTGAATGATACAGATCGAG
 
. : . : . : . : . : . :
JMFS157D02- CTAGGGATTTAGGATAAAAAAAAATCGCGTCCAAAGTGGCCACTTTGGACGCGATTGATT
                      ____________________________________________________________
consensus CTAGGGATTTAGGATAAAAAAAAATCGCGTCCAAAGTGGCCACTTTGGACGCGATTGATT
 
. : . : . : . : . : . :
JMFS157D02- AATATTCGCGTCCAAAGTACTGAGATTTGGACGCGAATAATAGAAGACTTTTAGTATTGG
                      ____________________________________________________________
consensus AATATTCGCGTCCAAAGTACTGAGATTTGGACGCGAATAATAGAAGACTTTTAGTATTGG
 
. : . : . : . : . : . :
JMFS157D02- CGTCCAAAGTACAGAGATTTGGACGCCAATACTGTTTTAAAATTAAAAAAAAAAAATTAT
                      ____________________________________________________________
consensus CGTCCAAAGTACAGAGATTTGGACGCCAATACTGTTTTAAAATTAAAAAAAAAAAATTAT
 
. : . : . : . : . : . :
JMFS157D02- TTATATAGTGGCATTTTAATTACAAAAATGCCACCGCATTACACTTTANGCATCCAAAGT
                      ____________________________________________________________
consensus TTATATAGTGGCATTTTAATTACAAAAATGCCACCGCATTACACTTTANGCATCCAAAGT